ID: 1049479765

View in Genome Browser
Species Human (GRCh38)
Location 8:142816329-142816351
Sequence TCTCACGGCCAGGCTCTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049479765_1049479772 12 Left 1049479765 8:142816329-142816351 CCGAGCAGAGCCTGGCCGTGAGA No data
Right 1049479772 8:142816364-142816386 CCTGTTTAAAGCGGTGCCCAGGG No data
1049479765_1049479768 3 Left 1049479765 8:142816329-142816351 CCGAGCAGAGCCTGGCCGTGAGA No data
Right 1049479768 8:142816355-142816377 ATGACTTGCCCTGTTTAAAGCGG No data
1049479765_1049479770 11 Left 1049479765 8:142816329-142816351 CCGAGCAGAGCCTGGCCGTGAGA No data
Right 1049479770 8:142816363-142816385 CCCTGTTTAAAGCGGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049479765 Original CRISPR TCTCACGGCCAGGCTCTGCT CGG (reversed) Intergenic
No off target data available for this crispr