ID: 1049482762

View in Genome Browser
Species Human (GRCh38)
Location 8:142834772-142834794
Sequence ACCCGCTTTCTGGAACTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 95}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049482762_1049482774 10 Left 1049482762 8:142834772-142834794 CCCGAAAGTTCCAGAAAGCGGGT 0: 1
1: 0
2: 1
3: 13
4: 95
Right 1049482774 8:142834805-142834827 GCGCGGGAGGCTCAGATGGCTGG 0: 1
1: 0
2: 3
3: 38
4: 1046
1049482762_1049482772 -3 Left 1049482762 8:142834772-142834794 CCCGAAAGTTCCAGAAAGCGGGT 0: 1
1: 0
2: 1
3: 13
4: 95
Right 1049482772 8:142834792-142834814 GGTGGGGAGGTCGGCGCGGGAGG 0: 1
1: 0
2: 2
3: 73
4: 773
1049482762_1049482770 -7 Left 1049482762 8:142834772-142834794 CCCGAAAGTTCCAGAAAGCGGGT 0: 1
1: 0
2: 1
3: 13
4: 95
Right 1049482770 8:142834788-142834810 AGCGGGTGGGGAGGTCGGCGCGG 0: 1
1: 0
2: 4
3: 52
4: 453
1049482762_1049482771 -6 Left 1049482762 8:142834772-142834794 CCCGAAAGTTCCAGAAAGCGGGT 0: 1
1: 0
2: 1
3: 13
4: 95
Right 1049482771 8:142834789-142834811 GCGGGTGGGGAGGTCGGCGCGGG 0: 1
1: 1
2: 2
3: 56
4: 466
1049482762_1049482778 20 Left 1049482762 8:142834772-142834794 CCCGAAAGTTCCAGAAAGCGGGT 0: 1
1: 0
2: 1
3: 13
4: 95
Right 1049482778 8:142834815-142834837 CTCAGATGGCTGGAGGCGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 299
1049482762_1049482773 6 Left 1049482762 8:142834772-142834794 CCCGAAAGTTCCAGAAAGCGGGT 0: 1
1: 0
2: 1
3: 13
4: 95
Right 1049482773 8:142834801-142834823 GTCGGCGCGGGAGGCTCAGATGG 0: 1
1: 0
2: 0
3: 18
4: 184
1049482762_1049482776 16 Left 1049482762 8:142834772-142834794 CCCGAAAGTTCCAGAAAGCGGGT 0: 1
1: 0
2: 1
3: 13
4: 95
Right 1049482776 8:142834811-142834833 GAGGCTCAGATGGCTGGAGGCGG 0: 1
1: 0
2: 5
3: 49
4: 482
1049482762_1049482777 19 Left 1049482762 8:142834772-142834794 CCCGAAAGTTCCAGAAAGCGGGT 0: 1
1: 0
2: 1
3: 13
4: 95
Right 1049482777 8:142834814-142834836 GCTCAGATGGCTGGAGGCGGCGG 0: 1
1: 0
2: 1
3: 34
4: 513
1049482762_1049482775 13 Left 1049482762 8:142834772-142834794 CCCGAAAGTTCCAGAAAGCGGGT 0: 1
1: 0
2: 1
3: 13
4: 95
Right 1049482775 8:142834808-142834830 CGGGAGGCTCAGATGGCTGGAGG 0: 1
1: 0
2: 0
3: 37
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049482762 Original CRISPR ACCCGCTTTCTGGAACTTTC GGG (reversed) Intronic
900605501 1:3521846-3521868 ACCCCCTTCCTGGCACTCTCTGG - Intronic
915062070 1:153194515-153194537 TCCCACTCTCTGGAACTTTTGGG + Intergenic
1066463248 10:35630878-35630900 ACTGGCTTTCTGTAACTTCCTGG + Intergenic
1074761880 10:116673187-116673209 ACCAGTTTTCTGCAACATTCAGG - Exonic
1075919386 10:126197869-126197891 ACCCGCTGTCTGGGGCTTTCAGG - Intronic
1078401108 11:11028149-11028171 ACCCCCTTTCTGTTGCTTTCAGG + Intergenic
1086936591 11:92751844-92751866 ACCCGTGTTCTGTCACTTTCCGG + Intronic
1089600970 11:119614731-119614753 ACCAGTTTTCTGTAACTTCCAGG - Intergenic
1093291103 12:17322816-17322838 GCCAGCTTTCTCCAACTTTCTGG - Intergenic
1095000744 12:36730330-36730352 ACCCGTTTTGTGGAATTTGCAGG + Intergenic
1095026479 12:37147113-37147135 ACCCGTTTTGTGGAATTTGCAGG + Intergenic
1095447522 12:42296860-42296882 ATCCACCTTCTGGAACTTACTGG - Intronic
1095992758 12:48048412-48048434 ACCATCTTTCTGAAACTTTGTGG - Intronic
1099628410 12:85107916-85107938 TCATGCTTTCTGGAACCTTCTGG + Intronic
1101098988 12:101372800-101372822 AGCTGCTTTCTGGAACTCACTGG - Intronic
1106173339 13:27307896-27307918 GCCTGCTTTCTGGAACTTCCTGG - Intergenic
1106882150 13:34143425-34143447 TCCGCCTTTCTGGAATTTTCAGG - Intergenic
1106903899 13:34384918-34384940 ACACTCTTCCTGGAACTGTCAGG + Intergenic
1107527283 13:41245822-41245844 ACCTGCTTTCTGGGACTTCCTGG + Intronic
1110144327 13:72170736-72170758 GCCCTCTTTCTGGATCTTTAGGG + Intergenic
1116624756 14:47250223-47250245 AACAGTTCTCTGGAACTTTCAGG + Intronic
1118337431 14:64865934-64865956 AACCGCTTTCTGGAACTGTTGGG - Intronic
1119381625 14:74232881-74232903 ACCTGCTTTCTGGGTCTTTGGGG + Intergenic
1124339346 15:28879906-28879928 CTCTGCTCTCTGGAACTTTCAGG + Intergenic
1125122630 15:36180605-36180627 AGTAGCTTTCAGGAACTTTCAGG + Intergenic
1128495800 15:68197868-68197890 ACCCACTTTCTTGAGCTTTGGGG - Intronic
1129120778 15:73395068-73395090 CCCAGCTTTCTGGAACATGCTGG + Intergenic
1130196198 15:81782384-81782406 GCCAGCTTTCTGGAACTTTCTGG - Intergenic
1130794843 15:87197016-87197038 ACCAGCTTTATGGAACTTCCGGG + Intergenic
1130989749 15:88869290-88869312 ACCTGCCTTCTGGAAGTTTCTGG - Intronic
1135680511 16:24452805-24452827 ATCAGCTTTGTAGAACTTTCTGG + Intergenic
1138495232 16:57404884-57404906 ACCCCCTCGCTGGATCTTTCAGG + Intronic
1139163455 16:64538584-64538606 ACCCCCTTTCTGGCTCTCTCTGG + Intergenic
1142315385 16:89341447-89341469 ACAGGCCTTCTGGAACCTTCTGG - Intronic
1142772806 17:2111702-2111724 ACCCGCTCTAAGGACCTTTCGGG - Intronic
1144774871 17:17780392-17780414 ACCAGTTTTCTGAAATTTTCAGG + Intronic
1145111823 17:20170433-20170455 ACAAGCTTTCTGGAAGTTTGTGG - Intronic
1145776512 17:27532726-27532748 ACAGGCTTTCTGGAAGGTTCTGG + Intronic
1149076241 17:52598349-52598371 TCCACCTTTCTGGAACTTTGTGG - Intergenic
1154658990 18:17171869-17171891 ACTCGTTTTGTGGAACCTTCAGG + Intergenic
1154669883 18:17320763-17320785 ACTCGTTTTGTGGAACCTTCAGG + Intergenic
1160348390 18:78153349-78153371 CTCAGCTTTCTGGAACTTTGTGG + Intergenic
1160806789 19:995445-995467 AGCAGCTTTCTGGAAGGTTCTGG - Intronic
1162931697 19:13960834-13960856 CCCTGCCTTCTGGAACCTTCTGG + Intronic
1164261381 19:23570939-23570961 GCCCCCTATCTGGAACTCTCTGG + Intronic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
936914183 2:117623367-117623389 ACCCGCTGTCTGGCACTCCCTGG - Intergenic
939327759 2:140716429-140716451 ACCTGCCTTCTGGAGCTCTCAGG + Intronic
941875598 2:170429633-170429655 ACAAGCTCTCTGGAACTCTCTGG + Intronic
945158284 2:206862072-206862094 AACTGCTTACTAGAACTTTCTGG - Intergenic
949001191 2:241614993-241615015 TTCTGCTTTCTGGAACTTACAGG - Intronic
1170471442 20:16672200-16672222 CCCATGTTTCTGGAACTTTCAGG + Intergenic
1178480919 21:32978673-32978695 AGCCGCTTTCTGGAATATGCAGG - Intergenic
1183068571 22:35380701-35380723 CCCAGCTTTCTGGAACCTTCTGG + Intronic
1183689366 22:39379671-39379693 ACTGGGTTTCTGGAACTTTGTGG + Intronic
1184344661 22:43905756-43905778 CCCTGCTTTCTGGAAGTTTCTGG - Intergenic
1185034324 22:48463579-48463601 AGCCACTTTCTGGAATATTCTGG + Intergenic
950003955 3:9679424-9679446 ACCCTCTTTCTGGTCCCTTCCGG + Intronic
953054917 3:39380418-39380440 ATCCTCTTTGTGGAAGTTTCTGG + Intergenic
954446132 3:50547803-50547825 ACCAGTTTTCAGGAATTTTCAGG + Intergenic
956245096 3:67174070-67174092 TCACCCTTTGTGGAACTTTCAGG - Intergenic
956723970 3:72141964-72141986 ACCTGCTTTCTCCAACATTCAGG - Intergenic
958293168 3:91863787-91863809 ACACTTTTTCTGGAATTTTCAGG + Intergenic
958302465 3:92015256-92015278 ACACTTTTTCTGGAATTTTCAGG + Intergenic
958316548 3:92245968-92245990 ACACTTTTTCTGGAATTTTCAGG + Intergenic
958332873 3:92513948-92513970 ACACTTTTTCTGGAATTTTCAGG + Intergenic
958342564 3:92673042-92673064 ACACTTTTTCTGGAATTTTCAGG + Intergenic
958376740 3:93233046-93233068 ACTCTTTTTCTGGAAGTTTCAGG + Intergenic
958382440 3:93325765-93325787 ACACTTTTTCTGGAATTTTCAGG + Intergenic
958388373 3:93422886-93422908 ACTCTTTTTCTGGAAGTTTCAGG + Intergenic
958399581 3:93606492-93606514 ACTCTTTTTGTGGAACTTTCAGG + Intergenic
958401693 3:93641193-93641215 ACTCTTTTTCTGGAATTTTCAGG + Intergenic
970531866 4:16993082-16993104 GAACACTTTCTGGAACTTTCTGG + Intergenic
973643769 4:52929667-52929689 TCCCGCTTTCTGGGCCTCTCTGG - Intronic
973721998 4:53733277-53733299 ATGTGCTTTCTGGAACTTTCTGG - Intronic
976564245 4:86535230-86535252 AAACTCTTTCTGGAACTTTCTGG - Intronic
978426107 4:108584301-108584323 ACCTCCTTTCAGGACCTTTCAGG + Intergenic
980089539 4:128428196-128428218 ACCTGCTCTCTGGAACTTGCTGG - Intergenic
981791672 4:148544609-148544631 ACCCCCTTTCTTGAATTTTAGGG - Intergenic
988334804 5:29893333-29893355 ACCTGCCTTCTGAAATTTTCAGG + Intergenic
993850028 5:92996442-92996464 ACCCTCTTTCTGAGAGTTTCTGG + Intergenic
993857181 5:93090868-93090890 ACCCTCTATCTGGAAATGTCGGG + Intergenic
1002627402 5:180540004-180540026 ACTTGCTTTCTGAGACTTTCTGG + Intronic
1002698317 5:181104797-181104819 ACATGCATTCTGGAACCTTCCGG - Intergenic
1002708579 5:181180111-181180133 ACATGCATTCTGGAACCTTCTGG + Intergenic
1003340574 6:5216406-5216428 ACCAGCTTTCCGGAATTTCCAGG - Intronic
1008364866 6:50665909-50665931 ACCAGCTTTTTGAAACTTTTTGG - Intergenic
1018008902 6:159649838-159649860 TCCCTCTTTCTGGTACTTGCTGG - Intergenic
1028223652 7:88224658-88224680 ACCCTTTTTCTTGAACTGTCCGG + Intronic
1028897248 7:96055834-96055856 ACCAGCTTTGTGGAAGTTTCTGG + Intronic
1030392419 7:108943548-108943570 ACCCACTTTCTGGCACTCCCCGG + Intergenic
1031158960 7:118143323-118143345 GCCCACTTTCTGAAACTTTGTGG - Intergenic
1031460036 7:122037455-122037477 CCCAGCTTTGTGGAACTTACTGG + Intronic
1036150174 8:6289778-6289800 ACAGGCTTTCTGGAAATTTCAGG - Intergenic
1037479320 8:19289299-19289321 TTCAGCTTTCTGGAGCTTTCTGG + Intergenic
1037969585 8:23162778-23162800 AACCGCTTCCTGCCACTTTCAGG + Intronic
1039989079 8:42472840-42472862 ACCTGCTTTCTAGAATTGTCAGG + Intronic
1040011407 8:42664061-42664083 ACTCTTTTTCTGGAAGTTTCTGG + Intergenic
1040915627 8:52564702-52564724 ACCCCATTTCTGGATCTTCCGGG - Intronic
1047448867 8:124944441-124944463 ACCCACTTTCAGAAACTATCTGG + Intergenic
1049456268 8:142691595-142691617 AGACTCTTTCTAGAACTTTCTGG - Intergenic
1049482762 8:142834772-142834794 ACCCGCTTTCTGGAACTTTCGGG - Intronic
1050306832 9:4313386-4313408 CCCTGCTTTCTGGATGTTTCTGG + Intronic
1056016355 9:82392317-82392339 AGCCCTTTTCTGGAACTTTTTGG + Intergenic
1056900743 9:90597158-90597180 CTCTGCTTTCTGGAGCTTTCTGG - Intergenic
1061230318 9:129312135-129312157 ACCCGGTTTATGGAAGTCTCTGG + Intergenic
1061609962 9:131739768-131739790 ACCTGCTTTCTCGATCTTGCCGG + Intronic
1189971078 X:46418917-46418939 ACCCACTTTCTTGATCTTCCTGG + Intergenic
1199205336 X:145142297-145142319 ATGCTCTTTCTGAAACTTTCAGG - Intergenic
1200080130 X:153572164-153572186 ACCCTCTACTTGGAACTTTCTGG + Intronic