ID: 1049483948

View in Genome Browser
Species Human (GRCh38)
Location 8:142841724-142841746
Sequence GAGGGCACCAGAGGGCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 659}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049483948_1049483960 12 Left 1049483948 8:142841724-142841746 CCTCAGAGCCCTCTGGTGCCCTC 0: 1
1: 0
2: 2
3: 49
4: 659
Right 1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG No data
1049483948_1049483962 19 Left 1049483948 8:142841724-142841746 CCTCAGAGCCCTCTGGTGCCCTC 0: 1
1: 0
2: 2
3: 49
4: 659
Right 1049483962 8:142841766-142841788 TGCAGAAGATGTATGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049483948 Original CRISPR GAGGGCACCAGAGGGCTCTG AGG (reversed) Intronic
900151250 1:1180223-1180245 GAGGGCAGCTGAGGGCCCGGCGG - Exonic
900322971 1:2094137-2094159 GATGGCGACGGAGGGCTCTGAGG - Intronic
900401128 1:2473387-2473409 GAGTGCATGGGAGGGCTCTGCGG - Intronic
900426613 1:2583212-2583234 GAAGGCATGAGGGGGCTCTGGGG - Intergenic
900736247 1:4301221-4301243 AAAGGCACCTGAGGCCTCTGAGG + Intergenic
901193480 1:7426296-7426318 CAGGGCACCCTAGGACTCTGAGG - Intronic
901253739 1:7802706-7802728 GAGGGCATCAGAGTCCTCTAAGG + Intronic
901745638 1:11371476-11371498 GAGGGCACCAGCTGCCTGTGAGG + Intergenic
902298413 1:15484154-15484176 GAGGGCTCCAGGGGCCTTTGTGG - Intronic
902382989 1:16061333-16061355 GAGGGCCCCAGGGGCCTCAGGGG + Intronic
902600466 1:17537420-17537442 GAGGGCACAACGGGGGTCTGGGG + Intergenic
903293660 1:22330239-22330261 GAGAGGGCCAGAGGGGTCTGTGG - Intergenic
904010702 1:27388573-27388595 GTGGCCACCAGATGGCTGTGAGG - Intergenic
904012785 1:27399328-27399350 GTGGGCACCAGAGGACTCTGAGG - Intergenic
904169109 1:28578967-28578989 GAAGGCATCAGAGGGCACCGTGG - Intergenic
904439392 1:30520443-30520465 GAGGGCAGAAGAGGGCTGGGTGG + Intergenic
905339010 1:37265701-37265723 GTGGGCAGCAGAGGGGTCTAGGG - Intergenic
905375545 1:37518094-37518116 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
907358791 1:53898062-53898084 CAGGGAAGCAGAGGGCACTGGGG + Intronic
908291252 1:62669732-62669754 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
909377156 1:74952565-74952587 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
909609241 1:77535634-77535656 GAGGGCAAGAGACAGCTCTGAGG + Intronic
910147946 1:84104799-84104821 AAGGGTTCCAGAGGGCTCTCTGG - Intronic
911954576 1:104217963-104217985 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
913161143 1:116147073-116147095 GAGAGCAAGTGAGGGCTCTGAGG + Intergenic
913692198 1:121289623-121289645 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
914145357 1:144990491-144990513 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
915765024 1:158354080-158354102 TAGGGCACCAGAGGGCTGAGAGG + Intronic
916178183 1:162060342-162060364 GAGGGGACAGGAGGGCACTGTGG + Intergenic
917026446 1:170647988-170648010 GAGGGAAACAGAGGGATATGGGG + Intergenic
918659838 1:187074334-187074356 GAGAGCAAGTGAGGGCTCTGAGG + Intergenic
919181670 1:194092233-194092255 GAGGGTACAAGAGGGTTCTGTGG - Intergenic
919412879 1:197268298-197268320 GATGGCACCTGGGGGTTCTGAGG + Exonic
919802062 1:201360000-201360022 GGGTGCCCCAGAGGGGTCTGGGG - Intronic
919895905 1:202009828-202009850 GAGGGCTCCAGCAGGCGCTGAGG + Exonic
920282539 1:204854815-204854837 GAGGCCAGGAGAGGGCTCAGAGG - Intronic
920479522 1:206307972-206307994 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
920509701 1:206541832-206541854 GAGGGCACCAGGAGCCACTGAGG - Intronic
920883233 1:209899319-209899341 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
921801724 1:219410495-219410517 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
921897018 1:220412274-220412296 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
922062592 1:222106381-222106403 CAGGGACCCAGAAGGCTCTGGGG + Intergenic
922215180 1:223514550-223514572 GAGGGGACCAGATGACACTGAGG - Intergenic
923206149 1:231760814-231760836 AAGGGCACTAGAGGGCCCAGGGG + Intronic
923268308 1:232333325-232333347 GTGGGCACTGGAGGACTCTGGGG - Intergenic
923573732 1:235140129-235140151 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1062787999 10:281307-281329 GAGGGCATCATGGCGCTCTGTGG + Exonic
1062823746 10:553415-553437 GAGTGCAGCAAATGGCTCTGTGG - Intronic
1064197701 10:13259444-13259466 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1066186218 10:33013135-33013157 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1066190179 10:33049068-33049090 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1066233961 10:33467876-33467898 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1067040986 10:42953172-42953194 GACGGGTCCAGAGGGGTCTGCGG - Intergenic
1068486414 10:57664972-57664994 GAGTGCAGCAAAGGGCTGTGGGG + Intergenic
1068774338 10:60854676-60854698 TCTGGCACCAGTGGGCTCTGAGG - Intergenic
1068902035 10:62280219-62280241 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1069871183 10:71534146-71534168 GAAGGAACCAGTGGGATCTGGGG - Intronic
1070311421 10:75276384-75276406 GAGGGCATCGGAGTGCTCAGAGG - Intergenic
1070560579 10:77563708-77563730 GAGGGCAAGAGGGGGATCTGTGG - Intronic
1070579890 10:77711318-77711340 GCGGGCACCCCTGGGCTCTGAGG + Intergenic
1071003672 10:80859078-80859100 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1072760415 10:98051810-98051832 GAGGCCAGCACAGGGCTCCGGGG - Intergenic
1073152793 10:101323161-101323183 GAGGGGCACAGAGGGCTTTGGGG + Intergenic
1074051389 10:109884004-109884026 AAGGGCACACTAGGGCTCTGAGG + Intronic
1074496298 10:113982896-113982918 GGGTGAACCAGTGGGCTCTGAGG - Intergenic
1074999151 10:118782744-118782766 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1075269464 10:121035861-121035883 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1076342607 10:129759956-129759978 GAGGACACAGAAGGGCTCTGGGG - Intronic
1076367274 10:129929697-129929719 GATGGCACCATGGTGCTCTGTGG - Intronic
1076475495 10:130748856-130748878 AAGGGCAGCAGAGGGCACAGAGG - Intergenic
1076686017 10:132198806-132198828 GAGGCCACACGAGGGCCCTGGGG - Intronic
1076922915 10:133464931-133464953 GTGGGCATTAGAGGTCTCTGGGG + Intergenic
1077018460 11:407148-407170 GAGGTCGGCGGAGGGCTCTGCGG + Exonic
1077072232 11:680601-680623 GAGGGCTGCGGAGAGCTCTGTGG - Intronic
1077199499 11:1298419-1298441 GTGGGGTCCAGAGGCCTCTGAGG + Intronic
1077257779 11:1596500-1596522 GAGGGGACGAGAGTGATCTGAGG - Intergenic
1077302024 11:1851866-1851888 GGAGGCACCAGAGGGATCCGTGG - Intergenic
1077339827 11:2021321-2021343 GAGGTGGCCAGAGGGGTCTGGGG + Intergenic
1078251979 11:9623555-9623577 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1078301284 11:10133822-10133844 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1078743773 11:14091845-14091867 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1080621360 11:33989942-33989964 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1080639408 11:34149977-34149999 GAGGGCACCATGGGTCTGTGCGG + Intergenic
1081124981 11:39311670-39311692 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1081329791 11:41788744-41788766 GAGAGCAAGTGAGGGCTCTGAGG + Intergenic
1081614082 11:44580085-44580107 GAGGGCAGGGCAGGGCTCTGTGG - Intronic
1081855378 11:46300118-46300140 ATGGGCACAAGGGGGCTCTGGGG - Exonic
1083332562 11:61905746-61905768 GAAGGCACCACAGCCCTCTGAGG + Intronic
1083590664 11:63892067-63892089 CAGAGCACCAGAGAGCTCTGTGG + Intronic
1083620139 11:64045192-64045214 GAGGGCACCAGCGGGCAGCGAGG - Intronic
1083840050 11:65299208-65299230 GAGGCCACCAAAGGGGGCTGAGG - Intronic
1083868038 11:65469030-65469052 GAGAGCTGCAGAGGGCGCTGTGG - Intergenic
1084107330 11:66988648-66988670 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1084116543 11:67045907-67045929 CAGGTCACCCCAGGGCTCTGGGG + Intronic
1084503098 11:69546420-69546442 GAGGGAACCAGAGGGGTCCTGGG + Intergenic
1084700145 11:70781355-70781377 GTGGGTACCATGGGGCTCTGAGG - Intronic
1084806234 11:71581179-71581201 GAGGGGACAAGAGTGATCTGAGG - Intronic
1084899014 11:72295740-72295762 GAGGGAGACACAGGGCTCTGGGG - Intronic
1085023723 11:73224565-73224587 CAGGGCACCTGGGGACTCTGAGG - Intronic
1085348442 11:75782937-75782959 GATGACCCCAGAGGGCTCTCAGG + Intronic
1086576239 11:88341720-88341742 GAGGGCACCAGGGTGCCTTGAGG - Intergenic
1088046571 11:105458795-105458817 GAGGGCATGAGAGAGATCTGGGG + Intergenic
1088392604 11:109331358-109331380 GGAGGCACCAGAGGGATTTGAGG + Intergenic
1088509823 11:110562781-110562803 AGGGGCACCAGAGAGCTTTGGGG - Intergenic
1088637745 11:111840168-111840190 GAGGGCAATACAGGGTTCTGAGG + Intronic
1089341759 11:117763045-117763067 GAGCTCACCAGAGTGGTCTGTGG - Intronic
1089363732 11:117908551-117908573 GAGGGCTGCAGAGGGTGCTGGGG + Intronic
1089373659 11:117979006-117979028 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1089650435 11:119909368-119909390 AAGGGCACCAGAGGTCTCCATGG + Intergenic
1090307767 11:125705220-125705242 GAGAGCAAGTGAGGGCTCTGAGG + Intergenic
1090352336 11:126115377-126115399 GAGGGAGGCAGAGGCCTCTGGGG + Intergenic
1090448114 11:126781720-126781742 AAGGACACCAAAGGGCTCTGTGG + Intronic
1091183112 11:133625350-133625372 GAAGGAACCAGAGGCCACTGCGG + Intergenic
1202822812 11_KI270721v1_random:76510-76532 GAGGTGGCCAGAGGGGTCTGGGG + Intergenic
1091902200 12:4153444-4153466 GATGGCTGCAGAGGGCTATGGGG + Intergenic
1092108066 12:5938117-5938139 GAGGTGCCCAGAGGGCTCTTTGG - Intronic
1092617241 12:10226150-10226172 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1093752492 12:22816860-22816882 ATAGGCACCAGTGGGCTCTGAGG - Intergenic
1094178003 12:27561542-27561564 GACGCCATCAGAGGGTTCTGAGG - Intronic
1094448636 12:30561476-30561498 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1094589390 12:31806307-31806329 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1094661196 12:32472134-32472156 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1094666404 12:32525516-32525538 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1094820293 12:34219193-34219215 GCGGGCACCAGTGGTCTCTCGGG + Intergenic
1097129021 12:56796357-56796379 GAGAGCAAGTGAGGGCTCTGAGG + Intergenic
1097895068 12:64817107-64817129 GAGGGCACTAGAGGAGTATGCGG + Intronic
1097980317 12:65731436-65731458 GAGTGCCACAAAGGGCTCTGAGG + Intergenic
1098759157 12:74402787-74402809 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1099740258 12:86625605-86625627 CAGTGCCCCAGAGGTCTCTGAGG - Intronic
1099790632 12:87330058-87330080 GAGGGCAAGCGAGGGCTCTGAGG - Intergenic
1100584621 12:95968976-95968998 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1101021546 12:100559224-100559246 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1101310624 12:103575481-103575503 GCGGGGACCAGAGGGCACTATGG - Intergenic
1101462048 12:104906031-104906053 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1101530755 12:105571193-105571215 GCTGGCATTAGAGGGCTCTGGGG + Intergenic
1101790220 12:107919202-107919224 CAGGGCAGTAGAGGGCTCTGGGG - Intergenic
1102152276 12:110697065-110697087 GAGGGCACCACAGTGCACTCCGG - Intronic
1102655809 12:114481360-114481382 GTGGGCACGAAAGGGCTCTGAGG + Intergenic
1102718638 12:114996987-114997009 GAGGGCAAGAGAGCTCTCTGGGG + Intergenic
1103219212 12:119229495-119229517 GAGAACACCAGAGGCCACTGGGG + Intergenic
1103321287 12:120094029-120094051 AATGGCACCAGAGGGGTCTGTGG + Exonic
1104317841 12:127720727-127720749 AAGGTCACCTGAGGACTCTGTGG + Intergenic
1104478210 12:129087843-129087865 GAGGACACCCCGGGGCTCTGCGG - Intronic
1104582556 12:130021897-130021919 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1104614603 12:130257172-130257194 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1104686773 12:130790907-130790929 GAAGGCACTTGAGGGCTTTGAGG + Exonic
1104858503 12:131912912-131912934 CAGGGCCCCAGGGGTCTCTGGGG + Intronic
1105722098 13:23127419-23127441 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1106475577 13:30095439-30095461 GAGGGCAAGAGAGTTCTCTGGGG + Intergenic
1106708023 13:32302160-32302182 GAGTACAACACAGGGCTCTGGGG - Intergenic
1106810866 13:33357823-33357845 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1107259465 13:38472948-38472970 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1107590544 13:41899097-41899119 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1108709265 13:53016979-53017001 GAGGGCATTAAGGGGCTCTGAGG - Intergenic
1108800089 13:54084254-54084276 TAGGCCACCAGTGGTCTCTGGGG - Intergenic
1109140960 13:58713926-58713948 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1111091451 13:83452710-83452732 GAGGGAGGCAGGGGGCTCTGTGG + Intergenic
1111748244 13:92296508-92296530 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1112002353 13:95222512-95222534 AAGGGCCCCAGAAGGCTGTGGGG + Intronic
1112748319 13:102552916-102552938 GGAGCCACCAGAGGGGTCTGAGG + Intergenic
1112769032 13:102775196-102775218 GAGGGCACTAGAGGTCACTTTGG - Intergenic
1113428926 13:110232267-110232289 GAGCAAACCAGATGGCTCTGGGG - Intronic
1113482765 13:110633547-110633569 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1113538217 13:111084389-111084411 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1113677971 13:112221560-112221582 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1113710244 13:112458685-112458707 GAGGGGAACAAAAGGCTCTGGGG - Intergenic
1113775358 13:112941925-112941947 AGGGCCACCAGAGGGCTCTTTGG + Intronic
1114455202 14:22849412-22849434 GGGGAGAGCAGAGGGCTCTGTGG + Intergenic
1114560397 14:23585400-23585422 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1114593453 14:23891599-23891621 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1114644889 14:24249822-24249844 GATGGCATGAGAGGCCTCTGCGG - Intronic
1116623930 14:47242287-47242309 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1117315491 14:54567410-54567432 GAGGGCATCAGAGGGTGCTGGGG - Intronic
1117464178 14:55975770-55975792 GAGGACACAAGCGGCCTCTGGGG + Intergenic
1117572010 14:57057133-57057155 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1118730770 14:68664778-68664800 GAGGGCACAAGATGGCCCAGAGG - Intronic
1118899483 14:69974447-69974469 GGGAGCATCAGAGGGTTCTGTGG + Intronic
1119734720 14:76974692-76974714 GAAGGCTGCAGAGGGATCTGGGG - Intergenic
1121344587 14:93126163-93126185 GAGGGCACCAGAGGTAGCTGGGG - Intergenic
1121590122 14:95099176-95099198 AAGGCCACCAGAGGGCACTTGGG - Intronic
1122715804 14:103696292-103696314 GCGGGCACCACCGGCCTCTGAGG - Intergenic
1122817071 14:104319153-104319175 CGGGGCAGCAGAGGGCTCTGGGG - Intergenic
1122982475 14:105197858-105197880 GCTGGCTCCAGAGGGCTCAGGGG + Intergenic
1122985732 14:105210795-105210817 GAGGGCACCTGAGAGCAGTGTGG + Intronic
1123026319 14:105425928-105425950 CAGCGCACCTGAGGGGTCTGAGG + Intronic
1123113758 14:105884661-105884683 AGGGGCTTCAGAGGGCTCTGAGG - Intergenic
1123115987 14:105894300-105894322 AGGGGCTTCAGAGGGCTCTGAGG - Intergenic
1123118010 14:105903409-105903431 AGGGGCTTCAGAGGGCTCTGAGG - Intergenic
1123120231 14:105913013-105913035 AAGGGCTTCAGAGGGCTCTGAGG - Intergenic
1123147039 14:106142122-106142144 CAGGACACCAGAGGGCACTCAGG - Intergenic
1123209080 14:106741339-106741361 TAGGGCACCAGAGGGCATTCAGG - Intergenic
1123218175 14:106831526-106831548 GAGGACACCAGGGGGCGCTGAGG - Intergenic
1123402952 15:20004588-20004610 AAGGGCTTCAGAGGGCTCTGAGG - Intergenic
1123502568 15:20903262-20903284 AAGAGCACCAGTGGGCTCTTGGG + Intergenic
1123512292 15:21011242-21011264 AAGGGCTTCAGAGGGCTCTGAGG - Intergenic
1123559817 15:21476929-21476951 AAGAGCACCAGTGGGCTCTTGGG + Intergenic
1123582882 15:21731634-21731656 GAGGACACCAGGGGGCGCTCAGG - Intergenic
1123596053 15:21914228-21914250 AAGAGCACCAGTGGGCTCTTGGG + Intergenic
1123619532 15:22174230-22174252 GAGGACACCAGGGGGCGCTCAGG - Intergenic
1124624879 15:31302150-31302172 GAGGGGACCAGTGGGAACTGTGG + Intergenic
1124807992 15:32905688-32905710 CTGGGCACCACAGGGCTCTTAGG + Intronic
1125112132 15:36046796-36046818 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1125480378 15:40075289-40075311 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1125509375 15:40284470-40284492 GTGGGCAGGAGAGGGCTCTCGGG + Intronic
1126061255 15:44784863-44784885 GGGGCCACTAGAGGGCTCTTTGG - Intergenic
1126115237 15:45201940-45201962 GAGGGAATGAGAGGGCACTGAGG + Intergenic
1126198463 15:45957489-45957511 TAGGGCTCCAGAGGGCCCTGTGG - Intergenic
1127259345 15:57316958-57316980 GTGGGGAACAGAGGGCCCTGCGG - Intergenic
1127323083 15:57866342-57866364 CTGGGCGCCAGGGGGCTCTGTGG + Intergenic
1128108514 15:65061551-65061573 AAGGACACCAGAGTACTCTGAGG - Intronic
1128110765 15:65074867-65074889 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1128357450 15:66938001-66938023 GAAGGATCCAGAGGGCTTTGGGG - Intergenic
1128670053 15:69567874-69567896 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1129280476 15:74480862-74480884 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1129322317 15:74782163-74782185 GAGGGCGGCAGCGGGCTCGGCGG - Exonic
1130259323 15:82343293-82343315 GAGGGCACTGTGGGGCTCTGTGG + Intronic
1130269354 15:82435872-82435894 GAGGGCACTGTGGGGCTCTGTGG - Intronic
1130281942 15:82525889-82525911 GAGGGCACTGTGGGGCTCTGTGG - Intergenic
1130484919 15:84393543-84393565 GAGGGCACTGTGGGGCTCTGTGG - Intergenic
1130535700 15:84783669-84783691 GTGGCCTCCAGAGGGCTCCGGGG - Exonic
1130595595 15:85246647-85246669 GAGGGCACTGTGGGGCTCTGTGG - Intergenic
1130829974 15:87589467-87589489 AAGGACACCAGAGGGCTGAGTGG + Intergenic
1130906887 15:88246983-88247005 GTGGCCACCAGAGGGCAGTGTGG - Intronic
1131188232 15:90293406-90293428 GAGGGCACTGTGGGGCTCTGTGG - Intronic
1131507709 15:93031671-93031693 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1131879285 15:96845432-96845454 GAGGGGAACAGAGGGATCTGAGG - Intergenic
1132292347 15:100712500-100712522 GTGGGCACCAGTGGCCTCAGGGG - Intergenic
1202968160 15_KI270727v1_random:204091-204113 AAGAGCACCAGTGGGCTCTTGGG + Intergenic
1132557235 16:578054-578076 GAGGGCTCCAGTGGGTCCTGTGG + Intronic
1132699196 16:1215111-1215133 GGGGGCCCCTCAGGGCTCTGGGG + Intronic
1132863326 16:2082068-2082090 GCGGGCTCCAGGAGGCTCTGCGG + Intronic
1133475126 16:6113649-6113671 AAGGACACCAGAGGGGTATGAGG + Intronic
1133870411 16:9680564-9680586 GAAGGCACAACAGGGCTTTGAGG + Intergenic
1133924348 16:10181723-10181745 AGGGGCACCAGGGGGCGCTGCGG - Intronic
1134302952 16:13007806-13007828 CAGGGCACAAGAGGGGTGTGAGG - Intronic
1134400440 16:13904995-13905017 AGGGCCACCAGAGGGCTCTTTGG + Intergenic
1134822347 16:17257012-17257034 GGAGGCAACAGAGAGCTCTGGGG - Intronic
1135352662 16:21742012-21742034 GAGGGCAGCAGCGCGATCTGTGG + Intronic
1135417340 16:22278586-22278608 CAGGGCCGCAGAGGGCACTGTGG + Intronic
1135451149 16:22558134-22558156 GAGGGCAGCAGCGCGATCTGTGG + Intergenic
1135554013 16:23420397-23420419 GAGGGGACCAGAAGGATGTGAGG - Intronic
1135928699 16:26718047-26718069 ATGGTCACCAGAGGGCCCTGGGG - Intergenic
1136182454 16:28563160-28563182 GGGGTGACCAGAGTGCTCTGGGG + Intronic
1136428400 16:30183903-30183925 CGGGGCCCCAGAGCGCTCTGCGG + Intronic
1136692136 16:32039792-32039814 GAGGACACCAGGGGGCGCTCAGG + Intergenic
1136692246 16:32040248-32040270 GAGGACACCAAGGGGCACTGAGG + Intergenic
1136792679 16:32983230-32983252 GAGGACACCAGGGGGCGCTCAGG + Intergenic
1136792743 16:32983477-32983499 GAGGACACCAAGGGGCACTGAGG + Intergenic
1136877113 16:33870577-33870599 GAGGACACCAAGGGGCACTGAGG - Intergenic
1136877177 16:33870824-33870846 GAGGACACCAGGGGGCGCTCAGG - Intergenic
1137465786 16:48707654-48707676 GAGGGCATAAGAGAGCTCTTTGG - Intergenic
1137587842 16:49674767-49674789 GAGGGCACCAGGGGACTCTGCGG + Intronic
1140318987 16:73929443-73929465 CAAGGCACCTTAGGGCTCTGTGG - Intergenic
1140720671 16:77768935-77768957 AAGGGAAGGAGAGGGCTCTGGGG - Intergenic
1140744761 16:77971741-77971763 GTGACCACCAGAGGGCGCTGCGG - Intronic
1141440833 16:84028725-84028747 GAGACCTGCAGAGGGCTCTGTGG - Intronic
1141659331 16:85433462-85433484 GTGGGCAGCAGAGGTCCCTGGGG - Intergenic
1141889615 16:86917947-86917969 GAGGGCTTCAGCGGGCACTGGGG + Intergenic
1142202977 16:88769948-88769970 CGGGGCAGCAGGGGGCTCTGAGG + Intronic
1142286441 16:89173367-89173389 AAAGGCCCCAGGGGGCTCTGTGG + Intronic
1203094891 16_KI270728v1_random:1244709-1244731 GAGGACACCAGGGGGCGCTCAGG + Intergenic
1203094999 16_KI270728v1_random:1245165-1245187 GAGGACACCAAGGGGCACTGAGG + Intergenic
1142480754 17:216799-216821 GAGGGCACATCAGGGCTCTGTGG + Intronic
1142505585 17:361436-361458 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1142663454 17:1447503-1447525 AAGAACACCTGAGGGCTCTGTGG + Intronic
1142805044 17:2367117-2367139 GAGGGGACCAGAAAGCTCTTTGG - Intronic
1143265032 17:5630210-5630232 GAGGGCAGCAGATGGCTCTCAGG + Intergenic
1143345076 17:6243290-6243312 CAGGGCACAAGACTGCTCTGAGG + Intergenic
1143565228 17:7716982-7717004 GAGGGTGCCAGGGGGCGCTGCGG - Intergenic
1143598396 17:7929232-7929254 GAGGGCCCCAGCGGGCGCTGGGG + Exonic
1143699868 17:8650406-8650428 GAGGGCAGGAGAGCTCTCTGGGG + Intergenic
1144182725 17:12767968-12767990 GAAGGCAGCTGAGGGCTGTGGGG - Exonic
1144723137 17:17486196-17486218 GAGAGCAAGTGAGGGCTCTGAGG - Intronic
1145247662 17:21280168-21280190 CTGGTCACCAGAGGGCGCTGTGG + Intergenic
1145731951 17:27197706-27197728 AAGGCCACCAGAGGGCTCCTTGG + Intergenic
1146006961 17:29166452-29166474 GGGGGCGGCAGAGTGCTCTGAGG + Exonic
1147239097 17:39078905-39078927 GAAGGTTTCAGAGGGCTCTGTGG - Intronic
1147994866 17:44354912-44354934 GCGGGCACCCGAAGGCTCGGCGG + Exonic
1148366259 17:47057800-47057822 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1148820140 17:50355341-50355363 GTGAGCACCAGAGGCCCCTGAGG - Intronic
1150457964 17:65323110-65323132 GATGACAGCAAAGGGCTCTGAGG - Intergenic
1150567795 17:66357259-66357281 GAGGGCACTAGAGGCAGCTGTGG + Intronic
1150832831 17:68539670-68539692 GAGGGCACACGAGTGCTCTCAGG + Intronic
1151326895 17:73385217-73385239 GAGGGCACAGGAGGGCTCCGCGG + Intronic
1152506226 17:80750523-80750545 GAGGGCACGGGAAGGCTATGAGG - Intronic
1152700306 17:81815259-81815281 GAGGGGACAGGAGGCCTCTGAGG + Intergenic
1152912443 17:83013140-83013162 GAGGGCAGGAGAGAGCTCTGTGG - Intronic
1153009792 18:528253-528275 AAGGGCAACAGAGCCCTCTGCGG + Intergenic
1153016792 18:589848-589870 AAGGATAACAGAGGGCTCTGGGG + Intergenic
1153832551 18:8935940-8935962 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1154121433 18:11655450-11655472 GATGGCACCGGCGCGCTCTGGGG + Intergenic
1155852200 18:30788287-30788309 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1157373684 18:47142603-47142625 GAGGGCAAAAGTGGGCTTTGAGG + Intronic
1159168033 18:64726147-64726169 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1159656192 18:71031856-71031878 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1159721841 18:71899976-71899998 GACGGCATCAGACTGCTCTGGGG + Intergenic
1159941240 18:74410679-74410701 GAGGAAACCTGGGGGCTCTGCGG - Intergenic
1160174700 18:76583367-76583389 CAGGGCACCACAGGGCTCCAAGG - Intergenic
1160868647 19:1267110-1267132 GCGGACACCAGGGGGCGCTGCGG - Intronic
1160964235 19:1738936-1738958 GAGGGTAAGTGAGGGCTCTGGGG - Intergenic
1161039624 19:2103312-2103334 GCCGGCACCTGAGGGCCCTGAGG + Intronic
1161062387 19:2221803-2221825 GGTGGAACCAGAAGGCTCTGTGG - Intronic
1161377483 19:3947364-3947386 GAGGGGACCAGAAAGCCCTGGGG - Intergenic
1161511974 19:4677019-4677041 CAGGGCACCAGATGTCCCTGAGG - Intronic
1161534337 19:4809756-4809778 GTGGCCACCAGAGGGCGCTGGGG + Intergenic
1161748231 19:6074853-6074875 GAGGCCACCAGAGGGAGCTGGGG + Intronic
1161847981 19:6723207-6723229 GAGGGCAGGAGAAGGGTCTGTGG + Intronic
1162335657 19:10058727-10058749 GAGGGACCCAGAGGGATGTGAGG - Intergenic
1162860677 19:13504436-13504458 GATTGCAACAGAGGGCACTGAGG - Intronic
1163252834 19:16136479-16136501 GAGGGCACCAGAGTCCTTGGCGG + Intronic
1163289891 19:16372480-16372502 GAGGGCTCCAGCGTCCTCTGTGG - Intronic
1163611784 19:18305433-18305455 GAGAGCCCCAGAGGCCTCTAAGG + Intergenic
1163642680 19:18470417-18470439 TAGGACACCAGAGGGCACTGTGG + Intronic
1163793918 19:19324715-19324737 GAGGGCACCATGTGGCTCAGTGG - Intronic
1163881861 19:19930593-19930615 AAGGCCACCAGAGGGCTCCTTGG - Intronic
1163885227 19:19959378-19959400 AAGGCCACCAGAGGGCTCCTTGG - Intergenic
1164310372 19:24041158-24041180 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1164483313 19:28632917-28632939 GAGGGCAGCACAGGCCTGTGGGG - Intergenic
1164975713 19:32571431-32571453 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1165829578 19:38723845-38723867 GAGGGGTCCAGAGGGCCCTGAGG - Intronic
1166649812 19:44563722-44563744 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1166805689 19:45485648-45485670 GAGGGGGCCAGAGGGCTGCGGGG + Exonic
1167578117 19:50327485-50327507 GAGGGGTCCAGAAGGCTGTGAGG + Intronic
1167699482 19:51034034-51034056 GAGGGCACCAGCCTGCGCTGCGG - Exonic
1167744587 19:51342998-51343020 GATGTCTCCAGAGGGCACTGGGG - Intergenic
1168230612 19:55028356-55028378 GAGGACTCCATAGGTCTCTGAGG - Intronic
1168406830 19:56114847-56114869 GTGAGCAGGAGAGGGCTCTGCGG - Intronic
925566796 2:5263612-5263634 AAGGACACAAGAAGGCTCTGGGG + Intergenic
926207881 2:10846989-10847011 GATGGGTCCAAAGGGCTCTGGGG - Intergenic
926222415 2:10944871-10944893 GAGGGCCCCACATGGATCTGGGG + Intergenic
926357864 2:12057575-12057597 AAGGGAACCACAGGGCCCTGAGG + Intergenic
927041806 2:19237661-19237683 GAGATGACCAGATGGCTCTGAGG - Intergenic
927178627 2:20427995-20428017 GACGACACGAAAGGGCTCTGGGG + Intergenic
927992014 2:27454520-27454542 GATGGAATAAGAGGGCTCTGCGG + Intronic
928374471 2:30763712-30763734 GTGAGCATCAGAGGGCCCTGGGG + Intronic
928753111 2:34494135-34494157 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
929044750 2:37778469-37778491 CAGGGCAGCAGTGGGGTCTGGGG + Intergenic
929410538 2:41693987-41694009 GAGGGCACCAGCTGGGCCTGAGG - Intergenic
929455799 2:42064177-42064199 GAAGGCACCAGAGGGGTCTCTGG - Intergenic
929666756 2:43839288-43839310 CAGGGTCCCAGAGGCCTCTGAGG + Intronic
930958817 2:57234059-57234081 GAGGGGAACAGAGAGCTCTTCGG - Intergenic
932239852 2:70148171-70148193 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
932486388 2:72086732-72086754 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
932682275 2:73836442-73836464 AATGGCACCAGAGGGGTCTGTGG - Intronic
933275318 2:80277838-80277860 AAGGGCAGAACAGGGCTCTGAGG - Intronic
933487336 2:82938962-82938984 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
934736201 2:96691147-96691169 GCGGGCACCTGAGGACTCAGAGG + Intergenic
935295842 2:101648758-101648780 AAGGGCACAAGAGGGCTTTCTGG - Intergenic
935471188 2:103462872-103462894 TAGGGCATCAGTGGCCTCTGTGG + Intergenic
936349612 2:111702840-111702862 AGGGGCACCAGACTGCTCTGTGG + Intergenic
936460143 2:112707978-112708000 CAAAGCACCAGACGGCTCTGAGG + Intergenic
937025448 2:118693442-118693464 GAGAGCTTCAGAGGGCGCTGGGG + Intergenic
937257112 2:120563472-120563494 GAGGTCCTCAGAGGGCTCTAGGG - Intergenic
937492810 2:122387565-122387587 GAGGGCACATGTGGGGTCTGTGG + Intergenic
937746520 2:125422089-125422111 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
937891540 2:126942936-126942958 GAGGGCCCCGCAGGGCTGTGAGG - Intergenic
937992939 2:127674397-127674419 GAGGTCACCAGAGGCCACAGAGG - Intronic
938288489 2:130137254-130137276 GAGGCCACCAGGGAGCTCAGCGG + Intergenic
938468042 2:131535682-131535704 GAGGCCACCAGGGAGCTCAGCGG - Intergenic
939777435 2:146404209-146404231 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
940638831 2:156327942-156327964 GAGGGCTCCTGTGGGCTCTTCGG + Exonic
941001686 2:160208966-160208988 GAGGGCATCGCAGGGCTCTCTGG + Intronic
941705956 2:168657956-168657978 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
941716907 2:168773819-168773841 TAGGCCACAAAAGGGCTCTGTGG + Exonic
941820705 2:169841375-169841397 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
942940802 2:181614099-181614121 GAGTGGACCAGCTGGCTCTGTGG + Intronic
943653097 2:190478270-190478292 TAGTGCAACAGAGGGCTCTGTGG + Intronic
943672711 2:190680466-190680488 GAGCACAGCAGAGGGCGCTGTGG - Intronic
943835082 2:192507814-192507836 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
944553285 2:200864809-200864831 GAGGGAACCAGAGCCCGCTGTGG + Intergenic
945176602 2:207049846-207049868 AAGAGCACCAGAGGGCCCAGTGG - Intergenic
945745691 2:213718333-213718355 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
946032822 2:216718421-216718443 GCGTGCAACAGAGGGCCCTGTGG + Intergenic
946293388 2:218763502-218763524 GGGGGCATGAGGGGGCTCTGGGG - Intergenic
946358172 2:219201944-219201966 GAGAGCAGGCGAGGGCTCTGAGG + Intronic
947109804 2:226706687-226706709 GAGGAAACCAGAGGGATCTTGGG - Intergenic
947317722 2:228879621-228879643 GAGAGCAAGAGAGGTCTCTGGGG + Intronic
948278108 2:236725559-236725581 CAGCTCACCAGAGGGCTCAGGGG - Intergenic
948456004 2:238104920-238104942 GGGGGCTCCAGAGGGAACTGGGG + Intronic
948691279 2:239706681-239706703 GAGGGAGCCAGAGGGCACTCTGG + Intergenic
1168765931 20:381547-381569 GGGGGCACTGGAGGACTCTGGGG + Intronic
1169398431 20:5257688-5257710 GAGGGCAAGAGAGCTCTCTGGGG + Intergenic
1169814543 20:9642107-9642129 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1170572248 20:17638968-17638990 GAGGGTCCCAGAGGGCCTTGGGG + Intronic
1171129816 20:22641600-22641622 GAAGACACCAGAGGGCTTTGAGG - Intergenic
1171223416 20:23421121-23421143 GGGGGCTCCAGGGGGCGCTGGGG + Intronic
1171310782 20:24143165-24143187 GAGGGCAGCCCAGGGCACTGTGG - Intergenic
1172128280 20:32638518-32638540 CAGGACACCAGAGGAGTCTGAGG + Intergenic
1172448906 20:35008080-35008102 GAGGGACCCAGAGGGCACAGCGG + Intronic
1172939793 20:38646305-38646327 GAGGCCACCAGGGGGCGTTGCGG + Intronic
1174167371 20:48594627-48594649 GAGAGCTCCAGATGGCCCTGTGG - Intergenic
1174169676 20:48608238-48608260 GAGGCCAGCACAAGGCTCTGGGG - Intergenic
1174332702 20:49832422-49832444 TAGGGGACCAGAGGGCGCTTGGG + Intronic
1175271098 20:57734732-57734754 GTGGGCTCCAGAGGGCTCGAGGG + Intergenic
1175542629 20:59757279-59757301 GAGGTCAGAAGAGGGCACTGAGG - Intronic
1175590757 20:60190063-60190085 GAGGGCACGAGAGCTCTCTGCGG - Intergenic
1175764507 20:61583171-61583193 GGGGGGGACAGAGGGCTCTGCGG + Intronic
1175847852 20:62067985-62068007 TTGGGCACCAGAAGGCCCTGGGG + Intergenic
1176028424 20:62998189-62998211 GAGGGCCCCAGAGATCTCTCAGG + Intergenic
1176039457 20:63056598-63056620 GAGGGCAGCAGAGGGCTGGCGGG + Intergenic
1176126105 20:63475595-63475617 GAGCCCACCAGAGGACTTTGGGG - Intergenic
1176372230 21:6068988-6069010 GAGGGCCCCAGAGTCCCCTGTGG - Intergenic
1176966709 21:15219101-15219123 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1178398656 21:32265174-32265196 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1178680574 21:34669766-34669788 GAGGGAGCCCGAGGACTCTGCGG + Exonic
1179111186 21:38446897-38446919 AAGGGCATCATAGGGCTGTGGGG - Intronic
1179137720 21:38695426-38695448 CAAGGCACCAGGGGTCTCTGAGG - Intergenic
1179657961 21:42857160-42857182 CAGGCCAGCAGAAGGCTCTGGGG + Intronic
1179751289 21:43469551-43469573 GAGGGCCCCAGAGTCCCCTGTGG + Intergenic
1180008658 21:45035146-45035168 GAGGGCCCCTGAGGACCCTGTGG - Intergenic
1180255459 21:46624396-46624418 GAAGGCTCCAGAGGCCTCTTTGG + Intergenic
1180982653 22:19886175-19886197 GAGGGCAGCCGAGGGCACAGTGG + Intronic
1181037775 22:20178212-20178234 GTGGGCGCCCGAGGGATCTGAGG - Intergenic
1181103049 22:20554380-20554402 GAGGGCTCCACAGAGCACTGAGG - Intronic
1181328687 22:22071841-22071863 GAGGGCACCAGTGTGATATGAGG + Intergenic
1181797087 22:25318773-25318795 GAGGGCCACACAGGGCCCTGGGG + Intergenic
1182582123 22:31320429-31320451 GAGGGCAGCTGAGGGTACTGAGG + Intergenic
1182681861 22:32085755-32085777 GCAGGCACCAAAGGGTTCTGTGG + Intronic
1183073382 22:35411597-35411619 GAGGGCAGCAGGGGCCACTGAGG + Intronic
1183207063 22:36426721-36426743 GGGGGCAAGAGAGGTCTCTGTGG + Intergenic
1183254965 22:36756343-36756365 GAGGGGACCAAACAGCTCTGGGG + Intergenic
1183317509 22:37145036-37145058 GGGGCTTCCAGAGGGCTCTGAGG + Intronic
1183358341 22:37371148-37371170 GAGGACAGCAGAGGGCTAGGAGG - Exonic
1183382837 22:37498947-37498969 GTGGAAACCAGAGGACTCTGGGG + Intronic
1184160943 22:42696973-42696995 GAGGAAACGAGGGGGCTCTGAGG - Intronic
1184247811 22:43244602-43244624 CAGGGCACAAGGGCGCTCTGTGG + Intronic
1184514358 22:44952900-44952922 GAGGGCAACCGAGGGCTAGGAGG - Intronic
1184584174 22:45436571-45436593 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1184668199 22:45999481-45999503 GATGGCACCTCAGGCCTCTGCGG - Intergenic
1184781627 22:46652516-46652538 GAGGTCACCAAGGGGCTCCGTGG + Intronic
1185045999 22:48529032-48529054 GAGGGCACTAGAACCCTCTGAGG + Intronic
1185084234 22:48729963-48729985 GAGGGCAGCAGCCGCCTCTGGGG + Intronic
1185119031 22:48954854-48954876 GAGGGAAGCAGATGGCTGTGAGG - Intergenic
1185292698 22:50035148-50035170 GACGGCTCCAGCGGGCCCTGGGG - Intronic
952275162 3:31869964-31869986 GAGAGCAGGCGAGGGCTCTGAGG - Intronic
952398153 3:32939526-32939548 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
952976137 3:38698142-38698164 AATGGCACCAGAGGGGACTGTGG - Exonic
953089738 3:39713159-39713181 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
953571843 3:44077428-44077450 AAGGGCAGCAGAGGGCGATGCGG - Intergenic
954040925 3:47887049-47887071 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
954287637 3:49630072-49630094 CAGGGCTCCAGATGGCTCGGGGG + Intronic
954407807 3:50355255-50355277 CAGGGCACCTGACTGCTCTGAGG - Exonic
954416059 3:50393996-50394018 GAGGGACACAGAGGGGTCTGTGG - Intronic
954434418 3:50488506-50488528 GAGGGCAGCAGAGAGTACTGAGG + Intronic
954745267 3:52784224-52784246 TGGGGCACGAGGGGGCTCTGGGG - Intronic
954938410 3:54348186-54348208 AAGGGCAGCAAAGGGGTCTGTGG - Intronic
955266539 3:57449863-57449885 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
955449400 3:59050701-59050723 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
956847412 3:73196133-73196155 GAGGCCACCAGGGGCCACTGAGG - Intergenic
956855173 3:73269036-73269058 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
959357258 3:105347831-105347853 GAGGGCAAGAGAGCACTCTGAGG + Intergenic
960973213 3:123153969-123153991 CAGGGCACAGAAGGGCTCTGAGG - Intronic
961333756 3:126158071-126158093 GAGGGCACCAGGAGGCGCAGGGG - Intronic
961460382 3:127046520-127046542 AAGGGCAAGCGAGGGCTCTGAGG - Intergenic
961504393 3:127360642-127360664 GAGTGCCACAGATGGCTCTGGGG - Intergenic
961532513 3:127547922-127547944 GTGGGCACCAGGGGGCGGTGCGG - Intergenic
962398833 3:135039935-135039957 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
962926636 3:139999575-139999597 GAGGGCCTCAGAGGGATCTCAGG + Intronic
963293572 3:143519539-143519561 GAAGGCACTAGAGGGTTTTGAGG + Intronic
963354080 3:144188418-144188440 GATGGCTCCAGATTGCTCTGTGG + Intergenic
964139308 3:153378854-153378876 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
964529745 3:157654698-157654720 GAGGGCAAGAGAGCTCTCTGGGG + Intronic
965753315 3:171999388-171999410 GAGAGCAACCGAGGGCTCTAAGG + Intergenic
967951985 3:194848205-194848227 GATGACAACAGAGGCCTCTGGGG - Intergenic
967974793 3:195027673-195027695 CAGGGCAGGAGAGGGCTCTGGGG + Intergenic
968181682 3:196599553-196599575 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
968397745 4:259416-259438 AAGGCCACCAGAGGGCTCCTTGG + Intergenic
968510487 4:993366-993388 GCGGGAGCCAGAGGGCCCTGCGG - Exonic
969116806 4:4875363-4875385 GGGGCCACCGGAGGACTCTGAGG + Intergenic
971308711 4:25505835-25505857 CCGGGCACCAGAGTGTTCTGTGG - Intergenic
971451775 4:26807425-26807447 GAGGGCAGGAAAGGGCTGTGGGG - Intergenic
971709386 4:30092551-30092573 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
971811869 4:31438495-31438517 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
972022861 4:34336158-34336180 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
972331295 4:38066697-38066719 GAGGGGAGCTGGGGGCTCTGGGG + Intronic
972778534 4:42265782-42265804 GAGAGCAAGTGAGGGCTCTGAGG - Intergenic
973308000 4:48675184-48675206 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
974641825 4:64640990-64641012 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
974804303 4:66860012-66860034 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
975755797 4:77570508-77570530 GAGAGCAAGTGAGGGCTCTGAGG - Intronic
976520712 4:86022125-86022147 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
976646946 4:87396463-87396485 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
979290902 4:118977563-118977585 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
979415605 4:120434588-120434610 AAGGGAACCAGAGGACTCTGAGG + Intergenic
979482604 4:121237169-121237191 ATGGGCAGCAGAGTGCTCTGCGG + Intergenic
980628513 4:135406461-135406483 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
981275746 4:142897346-142897368 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
982097390 4:151935374-151935396 GATGGCCCCAGATGGCTCTGTGG + Intergenic
984087922 4:175335010-175335032 GAGTGCTTCAGTGGGCTCTGGGG + Intergenic
984309388 4:178037607-178037629 GTCCTCACCAGAGGGCTCTGTGG + Intergenic
984770490 4:183433018-183433040 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
985103713 4:186482238-186482260 CAAGGCAGCCGAGGGCTCTGAGG + Intronic
985195255 4:187421465-187421487 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
985565583 5:613944-613966 GTAGGCACCACAGGGCTCTGAGG + Intronic
986199677 5:5569780-5569802 GAGGTCACCATGGGGCACTGGGG + Intergenic
987076299 5:14385144-14385166 GATGCCACCGGAGGCCTCTGAGG - Intronic
987315214 5:16717794-16717816 GAGAGCAAGTGAGGGCTCTGAGG - Intronic
987876868 5:23690968-23690990 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
987990321 5:25200539-25200561 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
988155140 5:27439967-27439989 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
988641146 5:33041809-33041831 GATGGCACCAGTGGCCTCTCCGG + Intergenic
988915980 5:35893385-35893407 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
990214598 5:53515904-53515926 GAGGGCAAGAGAGTGTTCTGAGG - Intergenic
992586504 5:78245486-78245508 GAAGCCACAAGAGGCCTCTGAGG - Intronic
993321016 5:86467198-86467220 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
993701703 5:91126535-91126557 AAGGCCACCAGACTGCTCTGGGG - Intronic
994509919 5:100689383-100689405 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
994605688 5:101962964-101962986 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
995596535 5:113753634-113753656 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
995679950 5:114704807-114704829 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
995768082 5:115640401-115640423 GAGGACACCAGAGGACACTCCGG - Intergenic
995920309 5:117304504-117304526 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
996245209 5:121255041-121255063 GAGAGCAACAGAGCTCTCTGTGG - Intergenic
997346756 5:133197808-133197830 GCGGTCTCCAGAGGGCTATGTGG + Exonic
997883159 5:137608530-137608552 GGGGGAAGCAAAGGGCTCTGAGG - Intergenic
999322084 5:150621768-150621790 CAGGGCAACACAGGGCCCTGTGG + Intronic
999324897 5:150637867-150637889 GAGGGTCCCAGCTGGCTCTGTGG + Intronic
999428030 5:151504364-151504386 GTGGGGACCAGAAGCCTCTGTGG - Exonic
999509395 5:152232577-152232599 GAGGGCAAGAGAGCTCTCTGGGG + Intergenic
1001221122 5:169901924-169901946 GAGGGTAGGAGAGGGCACTGTGG - Intronic
1001697107 5:173679073-173679095 GAGGCTATGAGAGGGCTCTGAGG + Intergenic
1001759338 5:174194578-174194600 GAGGTCACCTGGGGGCTCAGTGG - Intronic
1002168671 5:177363185-177363207 GAGGGCGGCAGAGGGCTGCGAGG - Intronic
1002170825 5:177373282-177373304 GAGGGCACCAAAGGTCTATAAGG + Intergenic
1003696518 6:8411121-8411143 GAGGGCAAGAGAGCTCTCTGGGG + Intergenic
1003717543 6:8665556-8665578 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1003862713 6:10337254-10337276 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1004068531 6:12275202-12275224 GCGGCCAACTGAGGGCTCTGAGG - Intergenic
1004534407 6:16486043-16486065 GAGGGCTCCTGAGGGCTCTTGGG + Exonic
1005035652 6:21552800-21552822 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1005332963 6:24766452-24766474 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1005750010 6:28873109-28873131 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1005759722 6:28957688-28957710 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1005821572 6:29603615-29603637 CAGGCCCCCAGAGGGTTCTGGGG + Exonic
1006008229 6:31020565-31020587 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1006044198 6:31280556-31280578 GAGGCCACCAGTGGGCATTGTGG + Intronic
1006143591 6:31945364-31945386 CAGGGCAGCAGAGGGCTCAGTGG - Exonic
1006152896 6:31998748-31998770 TATGGCACCAGAGAGGTCTGTGG + Intronic
1006159204 6:32031485-32031507 TATGGCACCAGAGAGGTCTGTGG + Intronic
1006170547 6:32089388-32089410 GAGAGCACCAGGTGGCTCAGGGG + Intronic
1006227146 6:32548439-32548461 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1006477746 6:34268868-34268890 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1007765314 6:44156342-44156364 GTGTGCACCACATGGCTCTGTGG - Intergenic
1007829982 6:44630528-44630550 GCGGGCTCCTGAGGGCTCTGGGG - Intergenic
1007930179 6:45683721-45683743 GAGGCCACCAGAAAGCTCTGGGG - Intergenic
1008005671 6:46406282-46406304 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1008592668 6:53009801-53009823 GATGGCACCAGAGGGCCAAGAGG - Intronic
1008770916 6:54979080-54979102 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1008774364 6:55018350-55018372 AAGGGAACTAGAGAGCTCTGTGG - Intergenic
1011246445 6:85325823-85325845 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1011601536 6:89064868-89064890 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1011870104 6:91882187-91882209 GAGAGCAAGTGAGGGCTCTGAGG + Intergenic
1013080152 6:106805609-106805631 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1013941029 6:115662812-115662834 GTGGGTACCAGAGGGAACTGTGG - Intergenic
1013955427 6:115835116-115835138 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1014240665 6:119015168-119015190 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1014336389 6:120142077-120142099 GAGGGAACCAGACGAGTCTGTGG - Intergenic
1014596247 6:123343979-123344001 GAGGGCAAGAGAGCTCTCTGGGG - Intronic
1014880148 6:126713743-126713765 AAGGGCTCTTGAGGGCTCTGTGG + Intergenic
1015572333 6:134634061-134634083 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1016069970 6:139726865-139726887 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1016797202 6:148130918-148130940 GAGGGGCCCAGAGGGCCCAGAGG - Intergenic
1017298904 6:152834187-152834209 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1017782694 6:157728725-157728747 TAGGACACCAGTGGGCACTGGGG - Intronic
1017862451 6:158411711-158411733 TAGGGCACCAGAGGGCTAGGAGG - Intronic
1018056413 6:160055970-160055992 GAGGGCACAGGAGGGCTCCTAGG - Intronic
1018258877 6:161949818-161949840 GAGGGCAGCACACGGCACTGGGG + Intronic
1018770908 6:166970882-166970904 GCGGTCACCTCAGGGCTCTGAGG - Intergenic
1018966966 6:168497015-168497037 GAGGGCTAGAGGGGGCTCTGTGG + Intronic
1019295315 7:270760-270782 GAGGGCAGGAGAGGCCGCTGGGG - Intergenic
1019375378 7:688550-688572 GAGGACAGCAGAGAGCCCTGGGG - Intronic
1019517892 7:1447721-1447743 GAGGGCCTCGGAGGACTCTGAGG - Exonic
1019524387 7:1474201-1474223 GCGAGCACCAGGGGGCGCTGTGG - Exonic
1019552133 7:1608340-1608362 GGGGGATCCAGGGGGCTCTGGGG + Intergenic
1019650959 7:2158190-2158212 CAGAGCAGCAGAGGGCTGTGGGG + Intronic
1020004718 7:4776171-4776193 GAGGCCATCCGAGGGCTTTGCGG + Intronic
1021324041 7:19245328-19245350 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1021689325 7:23216933-23216955 GAAGGCAACAGTGAGCTCTGTGG + Intergenic
1022462217 7:30620420-30620442 GAGGGCAAGAGAGCTCTCTGGGG + Intronic
1023369873 7:39502467-39502489 GAGGCCACTAGAGAGCTGTGAGG + Intergenic
1023982498 7:45078185-45078207 CAGGACACCAGAGGGCAGTGAGG + Intergenic
1023982607 7:45078626-45078648 GGGGACACCAGAGGGCGATGAGG + Intergenic
1023982862 7:45079886-45079908 GGGGACACCAGAGGGCAGTGAGG + Intergenic
1023982894 7:45080023-45080045 GGGGACACCAGAGGGCGGTGAGG + Intergenic
1023982954 7:45080272-45080294 GGGGGCACCAGAGGGCAGTGAGG + Intergenic
1024036140 7:45509145-45509167 GTGGCCACCAGAGGGGTTTGAGG + Intergenic
1024095943 7:45983006-45983028 GGCTGCAGCAGAGGGCTCTGGGG - Intergenic
1024406917 7:48992538-48992560 CAGGGCACAAAAGGCCTCTGTGG - Intergenic
1024833963 7:53494865-53494887 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1025158439 7:56631055-56631077 AAGGGCTTCAGAGGGCCCTGGGG - Intergenic
1026793543 7:73350802-73350824 GAGGCCACAGGAGGCCTCTGGGG + Intronic
1027051927 7:75026030-75026052 GAGGGAACCCGAGGGCCATGGGG + Intergenic
1027535533 7:79395523-79395545 GAGAGCCCCAGAGAGGTCTGTGG + Intronic
1027665810 7:81042553-81042575 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1028930368 7:96406414-96406436 GAGGGAAGCAGAGGTCTCTTTGG - Intergenic
1029201898 7:98844751-98844773 GAGGCCACCAGAAGGATTTGGGG + Intergenic
1029567429 7:101348419-101348441 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1029607592 7:101608550-101608572 GAAGGCACAAGATGGCTGTGAGG - Intergenic
1031292338 7:119952026-119952048 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1032077069 7:128841010-128841032 GAGGGCAGCAGGGGACACTGTGG + Intronic
1032080474 7:128856166-128856188 GGGGGTGCCAGAGAGCTCTGAGG - Intronic
1032087168 7:128890543-128890565 GTGGGGACTAGAGGGCTGTGGGG + Intronic
1032841279 7:135715666-135715688 GTGGGCACCACAGGGCTCTCCGG - Intronic
1033210581 7:139457255-139457277 GAGGGCCCCAGGCTGCTCTGAGG + Intronic
1033350159 7:140555571-140555593 GAGGGCTCTAGAGGGCTCCAGGG - Intronic
1034090961 7:148363661-148363683 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1034824348 7:154248100-154248122 GAGGGCAAGAGAGCTCTCTGGGG + Intronic
1035726243 8:1825526-1825548 TTGGGCACCAGCGGGCTGTGGGG - Intronic
1036239311 8:7068986-7069008 GAGGGCACCACTGGGATCTCTGG - Intergenic
1036820449 8:11935531-11935553 GAGGGCACCACTGGGATCTCTGG + Intergenic
1037702261 8:21285832-21285854 AAGAGCAGCAAAGGGCTCTGTGG + Intergenic
1037877393 8:22554706-22554728 GAGGGCTGAAGAGAGCTCTGGGG + Intronic
1037971424 8:23174305-23174327 GAGAGCAAGGGAGGGCTCTGAGG + Intergenic
1038173986 8:25164340-25164362 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1038482379 8:27910512-27910534 GAGGGCACCAGAGGCCACAGAGG + Intronic
1039061221 8:33573747-33573769 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1039637219 8:39179958-39179980 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1039842804 8:41305911-41305933 CTGGGGAACAGAGGGCTCTGTGG + Intronic
1039911305 8:41828961-41828983 GAGGGCGCCAGGGGGCGCTCTGG - Intronic
1040550581 8:48434297-48434319 CATGGCACCAGAAGTCTCTGAGG + Intergenic
1042083456 8:65082929-65082951 GAGGGAACCAAAGGGTTCTTCGG + Intergenic
1043435241 8:80231652-80231674 GAGAGCAAGAGAGGGCTCTGAGG - Intergenic
1044020420 8:87099289-87099311 GATGTCACCAGAGGCCTCTGTGG + Intronic
1044923417 8:97188847-97188869 GTGGGCCCCAGAGGGCACAGTGG - Intergenic
1045132021 8:99163915-99163937 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1045232407 8:100317302-100317324 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1045694942 8:104798275-104798297 GAGGACACGAGAAGGCCCTGCGG + Intronic
1045750278 8:105476153-105476175 GAGGTCATCAAATGGCTCTGAGG - Intronic
1046265473 8:111823799-111823821 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1047349955 8:124064368-124064390 GTGGGCTCCAGAGGACTCAGTGG - Exonic
1047571056 8:126099083-126099105 TATGGCACCAGAGGGCTCCAAGG + Intergenic
1047616506 8:126567101-126567123 GAGGGCAAGAGAGCTCTCTGGGG + Intergenic
1048857508 8:138697228-138697250 GAGGTCACCAGGGGGCAGTGGGG - Intronic
1049262448 8:141646831-141646853 CGGGGCACCAGAGGCCCCTGGGG - Intergenic
1049425372 8:142535707-142535729 GAGGGTACCAGAGGGACTTGGGG + Intronic
1049441703 8:142612603-142612625 GAGGGCGTCAGCTGGCTCTGCGG + Exonic
1049483948 8:142841724-142841746 GAGGGCACCAGAGGGCTCTGAGG - Intronic
1049606001 8:143529484-143529506 GAGGGCCCCAGGGACCTCTGAGG + Intronic
1050825730 9:9942975-9942997 AATGCCACCAGAGGGCACTGTGG - Intronic
1051342942 9:16128398-16128420 GAGAGGAGCAGAGGGCTCTGGGG - Intergenic
1051463719 9:17353779-17353801 GAGAGCAAGCGAGGGCTCTGAGG - Intronic
1052985440 9:34483294-34483316 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1053013195 9:34647041-34647063 GAGGGAGCTAGAGAGCTCTGAGG + Intronic
1053023144 9:34709432-34709454 GAGGGCAGAAGAGGGGTGTGAGG + Intronic
1053548003 9:39042873-39042895 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1053577276 9:39365213-39365235 GAGGCCACATGAGGTCTCTGTGG - Intergenic
1053841776 9:42193138-42193160 GAGGCCACATGAGGTCTCTGTGG - Intergenic
1054098847 9:60923903-60923925 GAGGCCACATGAGGTCTCTGTGG - Intergenic
1054120247 9:61199532-61199554 GAGGCCACATGAGGTCTCTGTGG - Intergenic
1054587507 9:66983030-66983052 GAGGCCACATGAGGTCTCTGTGG + Intergenic
1054775609 9:69121519-69121541 GAGGGCGCCAGCGGCCTCCGCGG - Intronic
1054777986 9:69139869-69139891 GAAGGCCCCAGGGGACTCTGTGG - Intronic
1055052226 9:71992287-71992309 GAGAGCACGAAAGGGTTCTGAGG + Intergenic
1055803749 9:80069567-80069589 GAGAGGACCAGGGAGCTCTGTGG - Intergenic
1056771484 9:89480935-89480957 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1056961825 9:91131796-91131818 GAGAGAACCACAGGCCTCTGTGG - Intergenic
1057135655 9:92685957-92685979 AAGGGCACCGGTGGGCTTTGTGG + Intergenic
1057333953 9:94141731-94141753 TTGGACACCAGCGGGCTCTGCGG - Intergenic
1057628725 9:96701435-96701457 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1058706314 9:107640572-107640594 GGGGGGCCCAGAGGGCTGTGGGG - Intergenic
1059021630 9:110582282-110582304 GAAGGGACTACAGGGCTCTGGGG - Intergenic
1060667473 9:125440569-125440591 GAAGGAACCAGAGGGCTCCCGGG + Intronic
1060758655 9:126230477-126230499 GGGGGCACCTGAGGGCTCCAGGG - Intergenic
1061626383 9:131842947-131842969 AAAGGCCCCAGAGGCCTCTGAGG + Intergenic
1061822992 9:133238851-133238873 GAGCCCTCCAGTGGGCTCTGAGG + Intergenic
1061858846 9:133457544-133457566 GGGGGCTCCAGTGAGCTCTGAGG + Intronic
1061940829 9:133882974-133882996 CAGGGTGCCAGAGGCCTCTGGGG - Intronic
1061944572 9:133901600-133901622 GAGGGCAGGAGAGGCCCCTGCGG - Intronic
1062001980 9:134220733-134220755 GTGGGCAGCAGAGGGCTCCGGGG + Intergenic
1062034160 9:134375416-134375438 GAGGGCAGCCGAGGGCTCCCGGG + Intronic
1062146287 9:134991532-134991554 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1062255506 9:135618990-135619012 GAGGGCAGCAGAGGGGTGAGGGG - Intergenic
1062482100 9:136757266-136757288 GAGGTCAGCAGATGGCTGTGAGG + Intronic
1062525661 9:136977163-136977185 GAAGTCACCAGAGGCCTCGGAGG + Intergenic
1062625032 9:137438733-137438755 ATGGGCATCAGAGGGCCCTGTGG + Intronic
1185446640 X:261320-261342 GAGGACTCCAGAGGCTTCTGTGG + Intergenic
1186152679 X:6691024-6691046 GAGAGCAAGTGAGGGCTCTGAGG + Intergenic
1187336959 X:18389726-18389748 CAGGGCACAAGAGAGCTCAGAGG - Intergenic
1187557662 X:20367367-20367389 GAGAGCAAGTGAGGGCTCTGAGG + Intergenic
1190414049 X:50163846-50163868 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1190740420 X:53284806-53284828 GTGGACACTAGAGGGCACTGTGG + Intronic
1192189617 X:68983059-68983081 GAGGGCACCTGGGGACTCTGAGG - Intergenic
1192790678 X:74379461-74379483 GGGGGTACTGGAGGGCTCTGTGG + Intergenic
1193804128 X:85972874-85972896 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1194166256 X:90521179-90521201 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1194476775 X:94368663-94368685 GAGGGCATCTCTGGGCTCTGGGG + Intergenic
1194650913 X:96512769-96512791 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1195709771 X:107764784-107764806 GTGGGCACCAGAGGAGCCTGGGG - Intronic
1196434226 X:115660232-115660254 CAGTGTACCAGAGTGCTCTGTGG - Intergenic
1196662604 X:118283222-118283244 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1196706000 X:118717457-118717479 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1196781547 X:119388102-119388124 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1196827359 X:119751346-119751368 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1197344913 X:125319581-125319603 GAGAGCAAGAGAGGGCTCTGAGG + Intergenic
1197723345 X:129759657-129759679 CTGTGCACCAGAGGGCCCTGGGG + Intronic
1197729011 X:129794564-129794586 GAGGGGACCAGAGGGGCCTCAGG + Exonic
1198664392 X:139004543-139004565 GAGAGCAAGCGAGGGCTCTGAGG + Intronic
1199831379 X:151551709-151551731 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1199880811 X:151973311-151973333 TAGGGCAAAAGATGGCTCTGGGG - Intronic
1200000289 X:153056587-153056609 GGGGTCCCCAGAGGGCTCTCCGG - Intronic
1200423650 Y:2998894-2998916 GAGAGCAAGTGAGGGCTCTGAGG + Intergenic
1200512525 Y:4098960-4098982 GAGAGCAAGGGAGGGCTCTGAGG - Intergenic
1200725926 Y:6667275-6667297 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1200824386 Y:7622734-7622756 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1200836858 Y:7740637-7740659 GAGGTCACAGGAGGGCTGTGGGG - Intergenic
1201479847 Y:14427933-14427955 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1202235669 Y:22708353-22708375 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic
1202307490 Y:23487815-23487837 GAGAGCAAGCGAGGGCTCTGAGG + Intergenic
1202367252 Y:24173943-24173965 AAGGGCACCGTGGGGCTCTGTGG - Intergenic
1202503529 Y:25496180-25496202 AAGGGCACCGTGGGGCTCTGTGG + Intergenic
1202563311 Y:26182771-26182793 GAGAGCAAGCGAGGGCTCTGAGG - Intergenic