ID: 1049483949

View in Genome Browser
Species Human (GRCh38)
Location 8:142841732-142841754
Sequence TGGGGAGAGAGGGCACCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 7, 3: 61, 4: 533}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049483949_1049483960 4 Left 1049483949 8:142841732-142841754 CCCTCTGGTGCCCTCTCTCCCCA 0: 1
1: 0
2: 7
3: 61
4: 533
Right 1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG No data
1049483949_1049483963 26 Left 1049483949 8:142841732-142841754 CCCTCTGGTGCCCTCTCTCCCCA 0: 1
1: 0
2: 7
3: 61
4: 533
Right 1049483963 8:142841781-142841803 GCCAGAGGCCCAGTGACCAATGG No data
1049483949_1049483962 11 Left 1049483949 8:142841732-142841754 CCCTCTGGTGCCCTCTCTCCCCA 0: 1
1: 0
2: 7
3: 61
4: 533
Right 1049483962 8:142841766-142841788 TGCAGAAGATGTATGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049483949 Original CRISPR TGGGGAGAGAGGGCACCAGA GGG (reversed) Intronic
900168289 1:1253721-1253743 TGGGGAGAGAGCCCTGCAGAGGG + Intergenic
900406131 1:2493796-2493818 TGGGGAGAGCGGGCAGCAGTCGG + Intronic
900833761 1:4984561-4984583 TGAGGAGGAAAGGCACCAGAGGG + Intergenic
900977948 1:6028762-6028784 TGGGGACAGTGGCCACCAGGAGG - Intronic
901056544 1:6451084-6451106 TGGGGAGGGAGGGGACCAGGTGG + Intronic
901716457 1:11158780-11158802 AGGGGAGAGGGGGCAGCATATGG + Intronic
902249800 1:15146865-15146887 TGGGGACAGAGGGGCCCAAAGGG - Intergenic
903006902 1:20304592-20304614 TGGTGACAGAGGGGACCAGAAGG + Intronic
903305203 1:22408400-22408422 GGGGCAGAGGGGTCACCAGATGG - Intergenic
903383865 1:22914353-22914375 TGGCGGGAGTGGGCACCAGGAGG - Intronic
904612369 1:31732614-31732636 TGGGGACAGAGGGCGCCTGCTGG + Intronic
904840202 1:33367717-33367739 GGAGGAGGGAGGGCAACAGAAGG - Intronic
904891779 1:33784622-33784644 TGGGGAGGGAGGGCCCTAGGTGG + Intronic
905866879 1:41381543-41381565 TGGGGAGAGAGGGGACGTGATGG - Intronic
905919672 1:41711109-41711131 AGGGAAGGGAGGGCACTAGAAGG - Intronic
906467432 1:46095516-46095538 GGGGGAGAGAGAGCATCAGGAGG + Intronic
907193144 1:52665389-52665411 TGGGGACAGAGGTCAGCAGGAGG + Intronic
907319821 1:53595186-53595208 TGGGGAGAGAGAGGAAGAGAAGG + Intronic
907641514 1:56195269-56195291 ATGGGAGAGAGGGTACAAGATGG + Intergenic
908021539 1:59903330-59903352 TGTGGGGAGAGGGCACTAGAGGG + Intronic
909493234 1:76248257-76248279 TGGCGAGAGAGGGACCAAGATGG - Intronic
909538086 1:76760650-76760672 AGGCCAGAGAGGACACCAGAAGG + Intergenic
910130404 1:83897818-83897840 TGGGGAGAGAGAGCGCAAGTAGG - Intronic
911102690 1:94106756-94106778 TGGGGAGAGAGGGCTTCAGAAGG + Intronic
912379092 1:109237220-109237242 TGGGAAGACAGGGTCCCAGAGGG - Intronic
914226069 1:145720695-145720717 TGGGGAGGGTGGGGACAAGAGGG - Intronic
914453679 1:147815915-147815937 GGGTGAGAGAGGGCAAAAGAGGG + Intergenic
914453683 1:147815935-147815957 GGGTGAGAGAGGGCAAGAGAGGG + Intergenic
914516661 1:148379920-148379942 TGGGGAGGGAGGGCAGGAGCGGG + Intergenic
915269791 1:154745922-154745944 TGGGCAGAGAGTCCAACAGACGG + Intronic
915328578 1:155094060-155094082 AGGGGAGACAGGCCAGCAGAGGG + Intergenic
915552666 1:156644346-156644368 AAGGGAGGGAGGGCACCAGAAGG + Intronic
915664003 1:157428441-157428463 TGGTGAGAGAGGGAGCAAGACGG + Intergenic
916197303 1:162236591-162236613 AGAGGAGAGAGGGGACTAGAGGG - Intronic
916418715 1:164616292-164616314 GGGGCTGAGAGGGCAGCAGAAGG - Intronic
917450212 1:175141712-175141734 GGGGGAGAGTGGGCCTCAGAGGG + Intronic
917451142 1:175148391-175148413 TGGGGAAGGAAGGCACCAGAGGG - Intergenic
917672052 1:177282154-177282176 TGGGGGGAGGAGGCAGCAGAGGG - Exonic
919924420 1:202185072-202185094 TGGGCAGAGAAGGCACCAAGGGG + Intergenic
919926115 1:202192732-202192754 TGGGGAGATAGGGCAAAAAAAGG + Intergenic
920122724 1:203670853-203670875 GGAGGAGAGAGGGCAGGAGAAGG - Intronic
920578924 1:207086224-207086246 TGGGGAGAGAGGGCTGAGGAGGG + Intronic
923032922 1:230264071-230264093 TGGGGATTGAGAGCACCAGATGG + Intronic
923501704 1:234570732-234570754 TTGGGAAAGAGGCCAGCAGAGGG - Intergenic
924619449 1:245648003-245648025 TGGGGAGAAAGGGCAGGGGAGGG + Intronic
1062832275 10:613875-613897 TGGGGAGTGATGCCATCAGATGG - Intronic
1063536129 10:6885447-6885469 TGGGGAGAGAGAGGAACACATGG + Intergenic
1063696078 10:8336216-8336238 GGGGGAGAGAGGGAAGGAGAGGG - Intergenic
1064231959 10:13536932-13536954 TGTCAACAGAGGGCACCAGAGGG - Intergenic
1064982030 10:21174386-21174408 TGGGGAGGGAGGGATCCAGGCGG + Intergenic
1065818769 10:29506596-29506618 TGGGGAGACAAGGCCCTAGAGGG + Intronic
1065866477 10:29919341-29919363 AGGGGAGAGAGGACATAAGAAGG - Intergenic
1067468848 10:46521900-46521922 TGGTGAGAGAGGAAACAAGAGGG + Intergenic
1067476975 10:46573835-46573857 TGGAGAGAGAGGGCGGCAGAGGG - Intergenic
1067518405 10:46974714-46974736 TGGTGAAAGAGGACACAAGAGGG + Intronic
1067535487 10:47106698-47106720 TTGGGAGAGAGCTCCCCAGAGGG - Intergenic
1067617764 10:47767946-47767968 TGGAGAGAGAGGGCGGCAGAGGG + Intergenic
1067643844 10:48077114-48077136 TGGTGAAAGAGGACACAAGAGGG - Intergenic
1068521632 10:58083684-58083706 TGTGTAGAGAGGGTAACAGAAGG + Intergenic
1068561020 10:58513739-58513761 AGGGGAGAGAGTGAAACAGACGG - Intronic
1068827949 10:61460932-61460954 TGAGGAGAGAGTTCACCAAATGG + Intergenic
1069047589 10:63759508-63759530 TGGGGAGAGAGGGAAGAGGAGGG + Intergenic
1069080459 10:64083304-64083326 TGGGGAAAGAGGACAGCAAAAGG - Intergenic
1069123957 10:64606019-64606041 AGGAGAGAGAGGGCACATGAAGG - Intergenic
1069316890 10:67115747-67115769 TGGGGAGAGAGGGCAAAAGTTGG + Intronic
1071387759 10:85139565-85139587 TGGAGAGAGAGGGTAACAGAGGG + Intergenic
1071718828 10:88122685-88122707 GGGGGAGAGAGGACAGCATAAGG + Intergenic
1072577963 10:96717644-96717666 TGGAGAGAGGGGGCAAGAGACGG + Intronic
1073151348 10:101313731-101313753 TTGGGAGAGAGGCCAGCAGAAGG + Intergenic
1074080673 10:110165927-110165949 GGGGGATAAAGGCCACCAGATGG - Intergenic
1074753057 10:116605667-116605689 TGGGGAGAAGGGGCCACAGATGG - Intronic
1074805136 10:117042387-117042409 TTAGGAGAGAGGGGAGCAGAAGG - Intronic
1075793099 10:125099517-125099539 TGGAGAGAGATGGCTCCAGTTGG - Intronic
1075870841 10:125771992-125772014 TGGTGAGAGAGGACACAGGAGGG + Intronic
1075872784 10:125782847-125782869 ATGGGAGAGAGGCCAGCAGATGG - Intergenic
1076238491 10:128884098-128884120 TCGGAAGAGTGGACACCAGAAGG - Intergenic
1076249068 10:128970804-128970826 TGGGGAGGGAAGGCAACCGAGGG - Intergenic
1076629123 10:131842076-131842098 TGGCCAGAGAGGGCAGGAGAGGG + Intergenic
1076735616 10:132457685-132457707 TGGGGAGGGAGGGCAGGGGAGGG + Intergenic
1076738106 10:132467688-132467710 TGGGGAGACTGGGCAGCAGGTGG - Intergenic
1077032369 11:474311-474333 AGGTGGGTGAGGGCACCAGATGG + Intronic
1077109954 11:857985-858007 GGGGCAGACAGGGCACCAGGGGG - Intronic
1078091302 11:8266305-8266327 AGTGGAGAGAGGCCATCAGATGG - Intronic
1078633390 11:13027208-13027230 TGGGAGGAGAGAGCACCTGAAGG + Intergenic
1079130275 11:17743365-17743387 TGGGGAGGGAGAGACCCAGACGG - Intronic
1081860760 11:46332388-46332410 TGCCTAGAGAGGGCCCCAGATGG - Intergenic
1082029603 11:47594664-47594686 TGGGGAGAGAGGGCTAGAGCTGG + Intergenic
1082043332 11:47705251-47705273 AGGGGAGAGAAGGCATGAGATGG + Intronic
1082683498 11:56209174-56209196 AGGGGAGAGAGGGAAGAAGAGGG + Intergenic
1082933524 11:58633509-58633531 TGAGGAGAGAGGGCACACGATGG - Intergenic
1083681527 11:64353979-64354001 GGGGGCAAGAGGGCACAAGAGGG - Intronic
1083714097 11:64565784-64565806 TGGGGAAAGAGGATCCCAGAGGG + Intronic
1083802357 11:65053887-65053909 TGGGAGGAGAGGGCACCTGGAGG + Intronic
1083802430 11:65054203-65054225 TTGGGGGAGAGGGCAACTGAGGG + Intronic
1083860714 11:65418562-65418584 TTGAGGGAGAGGGCATCAGAGGG - Intergenic
1084217712 11:67659378-67659400 CAGGGAGACAGGCCACCAGATGG + Intergenic
1084939353 11:72604095-72604117 AGGGCAGAGTGGGCACCAGTGGG - Intronic
1084943918 11:72628870-72628892 TGGAGAGAGTGGGGACCCGAGGG - Intronic
1085043407 11:73340061-73340083 TGGGGGCTGAGGGCACCAGGTGG - Intronic
1087508475 11:99058884-99058906 TGGGGAGAAAGGGAAACTGATGG + Intronic
1088454994 11:110024092-110024114 TGGGGAGGGAGGGAAGGAGATGG + Intergenic
1089255685 11:117192732-117192754 AGGGGAGAGTGGGGACCAGCTGG + Intronic
1089584661 11:119502661-119502683 TGGAATGAGAAGGCACCAGAGGG + Intergenic
1090012785 11:123060495-123060517 TGGCGAGGGAGGGGAACAGATGG - Intronic
1090455917 11:126849679-126849701 TGGGGAGAACGGGCACTTGATGG + Intronic
1090719617 11:129459546-129459568 TGGGAAGAGATGCCACCAGAAGG - Intergenic
1090939563 11:131375182-131375204 TGGGGAGATAGGCCCGCAGAGGG - Intronic
1090944969 11:131421400-131421422 GGGGGAGAGGAGGCATCAGAGGG + Intronic
1091120183 11:133050949-133050971 TGGGGACAGAGAGCACCTGTTGG - Intronic
1091224345 11:133948754-133948776 AGGGCAGAGTGGGCAACAGAAGG + Intronic
1091291561 11:134443157-134443179 TGGGGAGTGCGGGACCCAGATGG - Intergenic
1092189804 12:6510847-6510869 TGGGGAGATAGGGGAATAGATGG + Intronic
1092285106 12:7124176-7124198 TGGGGAGAGAGGGGAAGTGAGGG + Intronic
1092507015 12:9112705-9112727 TGGGGAGACAGGACACAAGGTGG + Intronic
1094075276 12:26465605-26465627 GAGAGAGAGAGGGCGCCAGAGGG - Intronic
1095097252 12:38155288-38155310 AGGGGAAAGAAGGCCCCAGAGGG + Intergenic
1095097423 12:38155914-38155936 AGGGGAAAGAAGGCACCCGAGGG + Intergenic
1095882688 12:47155001-47155023 TGCAGAACGAGGGCACCAGATGG + Intronic
1096660936 12:53123628-53123650 TGGGAAGAGATGGAACAAGAAGG - Intronic
1096805966 12:54141297-54141319 TGGGGAGAGAGGGGACAGGTGGG - Intergenic
1096928037 12:55170996-55171018 TGGAAAGAGAGGGAACCACAGGG + Intergenic
1097133841 12:56835233-56835255 TGGGGAGCCAAGGCATCAGAAGG - Intergenic
1097175358 12:57139303-57139325 TGTGGGGACAGGACACCAGATGG - Intronic
1097238267 12:57554766-57554788 TGGCGAGAGAGGGAAAAAGAGGG + Intronic
1098132807 12:67368159-67368181 AGGTGAGAGAGAGCACCAGGAGG - Intergenic
1098394065 12:69999769-69999791 TGCTAAGAGAGGGCACTAGAGGG - Intergenic
1100854412 12:98746136-98746158 GGGGAAGAGAGGGCACCATGTGG + Intronic
1101518808 12:105462682-105462704 TGGGGTGAGGGGGAACCAAAAGG + Intergenic
1102463531 12:113114914-113114936 TGGGGGCAGGGGGCACCACACGG + Intronic
1102648726 12:114421250-114421272 TGGGGAGAGGAGGCAGGAGAAGG + Intergenic
1103075004 12:117974907-117974929 TGCGGAGAGAGGGCAGCAGGAGG - Intergenic
1103343427 12:120233672-120233694 TAGGCAGAGAGGGCAACAGTGGG - Intronic
1103953911 12:124566500-124566522 CGGGGAGTGAGGGCACCCGTGGG - Intronic
1104609135 12:130214065-130214087 TAGGGAGAGAGGGGATCAAAGGG - Intergenic
1104648995 12:130517546-130517568 TTGGGAGAGTGGGCACCAATGGG + Intronic
1106093865 13:26625002-26625024 TGGGCAGAAGGGGCATCAGATGG + Intronic
1106844956 13:33728559-33728581 TGGGGAGGGAGGAGACAAGATGG - Intergenic
1108459600 13:50652070-50652092 TGTGCAGAGAGGGCAGCAGCTGG + Intronic
1110011940 13:70347096-70347118 TGGGGAGAGAGGGATGAAGAGGG + Intergenic
1110241855 13:73276657-73276679 TGGTGAGAGAGGGCACAAGGGGG - Intergenic
1110322480 13:74175742-74175764 TGTGGAGCAAAGGCACCAGAGGG + Intergenic
1111646365 13:91036680-91036702 TGGGGAGTGAGGGCTTCAAATGG + Intergenic
1113122196 13:106935345-106935367 TGGGGAGAGAGGAGCCAAGATGG - Intergenic
1113438871 13:110313216-110313238 TGAAGGGAGTGGGCACCAGAGGG - Intronic
1113600284 13:111563472-111563494 AGGGGAGAGAGGGAAACAGGAGG - Intergenic
1114140110 14:19900285-19900307 TGGGGAGAAAGTGCATCACATGG - Intergenic
1114200499 14:20515532-20515554 TGGGGAGACAGTGCTCCAAAGGG - Intergenic
1114416905 14:22551011-22551033 TGGGGAGAGAGGACATGAGGAGG - Intergenic
1114462070 14:22892804-22892826 TGGGGTGAGAGGTCAGCAGAGGG + Intergenic
1114533809 14:23410873-23410895 TGGGGAGAGAGGAAAAGAGAGGG - Intergenic
1114618741 14:24082346-24082368 AGGGGACAGAGGGCAGGAGAAGG - Intronic
1114701923 14:24687367-24687389 TGGTGAGAGAAGGCATCTGAGGG - Intergenic
1116251424 14:42488072-42488094 AAGGGAGAGAGGGTAACAGAGGG + Intergenic
1116979372 14:51151743-51151765 TGGTGAGAGAGGGCATCTGACGG - Intergenic
1117438563 14:55740397-55740419 TGGGGACAGAGGGCAGCTGTGGG + Intergenic
1117617278 14:57546424-57546446 AGGGAAGAGGGGGGACCAGAAGG + Intergenic
1118796941 14:69152668-69152690 TGGGGACAGAGGGCAGGAGGAGG + Intronic
1119766227 14:77189899-77189921 GGGGATGAGAGGGCAGCAGAGGG - Intronic
1119866989 14:77982167-77982189 TGGGGGGAGGGGGCACCTGAGGG - Intergenic
1121617224 14:95320754-95320776 TGGGGAGGGAGGGGACCGGAAGG - Intergenic
1121919472 14:97867542-97867564 TGGGGAGACAGGACAGGAGATGG + Intergenic
1122145431 14:99685807-99685829 GAGAGAGAGAGAGCACCAGAAGG - Intronic
1122522708 14:102356859-102356881 TGGGGAGAAAGGGGAGCAGCCGG - Intronic
1122534248 14:102451166-102451188 GAGGGAGCCAGGGCACCAGAGGG + Intronic
1122843094 14:104476222-104476244 TGGCAGGGGAGGGCACCAGAAGG + Intronic
1124013833 15:25860391-25860413 TAGGGACAGATGGCACCATAGGG - Intronic
1124571941 15:30872662-30872684 TGGTGAGAGAGGGAGCAAGAGGG - Intergenic
1125024365 15:35015768-35015790 TGGGGAGAGTGGGTACCAGAGGG + Intergenic
1125758297 15:42080926-42080948 GGGGCAGAGTGGGCACCAGAGGG - Intronic
1125929845 15:43592864-43592886 AGGAGAGAGAGAGCAGCAGAGGG + Intergenic
1125943012 15:43692696-43692718 AGGAGAGAGAGAGCAGCAGAGGG + Intergenic
1125956461 15:43793930-43793952 GGGGGAGAGAGGCTACCTGAGGG - Exonic
1126154013 15:45548339-45548361 AGGGGAGAGATGGCTACAGATGG - Intergenic
1126763016 15:51986865-51986887 AGGGGAGAAATGGCAACAGAGGG - Intronic
1127232420 15:57011344-57011366 TGGGGAGAGCAGGAACAAGAGGG - Intronic
1127672294 15:61206746-61206768 TGGGCAGAGAGGGCTGCTGAGGG - Intronic
1127961811 15:63895825-63895847 TGGGGAGAGAGGGCCCCAGGAGG - Intergenic
1128359788 15:66953970-66953992 TGGGAAGAGAGGGCACGTGATGG + Intergenic
1128543851 15:68554601-68554623 TGTGGGGAGTGGGCAACAGATGG - Intergenic
1128725803 15:69987819-69987841 TGGGGAGAGAGGGCATTAGAGGG - Intergenic
1129190677 15:73935793-73935815 TGGGGAGAGACAGCAGCAGAAGG - Intronic
1129879196 15:78995994-78996016 GGGGCTGAGAGGGCCCCAGAAGG - Intronic
1129885052 15:79031734-79031756 AGGGGAGAGAGAGCACGAGGGGG + Intronic
1129907016 15:79195565-79195587 TGGGGAGAGAGGAGAGGAGAGGG + Intergenic
1129912483 15:79240025-79240047 TGAGGAGAGAAGTAACCAGAGGG + Intergenic
1130018173 15:80203173-80203195 TGGGGAGAGGGAGCAGCAGCCGG - Intergenic
1131410350 15:92202072-92202094 TGGTGAGAGAGGGAGCAAGAGGG - Intergenic
1131453444 15:92564926-92564948 TGGTGAGAGAGGGAGCAAGAGGG + Intergenic
1131946100 15:97623586-97623608 TGGGGAGAGCAGGCATCAGTGGG + Intergenic
1132483913 16:180605-180627 TGGGGAGGGAGGGCCCCTGGGGG - Intronic
1132664755 16:1076284-1076306 TGGGGAGAGAGGGAGGGAGAGGG - Intergenic
1132666162 16:1082219-1082241 TGGGGAGGGTGTGCACCTGATGG - Intergenic
1132930290 16:2455572-2455594 TGGGGCCAGGGTGCACCAGAAGG + Intronic
1133007794 16:2894414-2894436 TGGGGAGATCGGCCGCCAGAGGG + Intronic
1133228620 16:4355373-4355395 CTGGGAGAGAGGGCAGAAGAAGG + Intronic
1133247950 16:4461734-4461756 TGGGGATCGGGGGCACCAGAGGG - Exonic
1133449175 16:5889220-5889242 TGGGGAGGGAGAGCATCAGGAGG - Intergenic
1134455424 16:14391810-14391832 TGGGGAGAGAGAGAAAGAGAAGG + Intergenic
1135113687 16:19709105-19709127 TGGAGAGAAAGGGCACCCCAAGG + Intronic
1135937790 16:26795796-26795818 TGGGGAGAGGAGACACAAGAAGG + Intergenic
1136082091 16:27858964-27858986 TGGAGGGAGAGAGCCCCAGATGG + Intronic
1136455765 16:30378842-30378864 TGGGGAGAGAGGGGGAGAGAGGG + Intronic
1137402078 16:48162125-48162147 TGGCAGGAAAGGGCACCAGAAGG + Intergenic
1137445507 16:48529516-48529538 TGGGAAGAGGGGGCACCACCAGG + Intergenic
1137561074 16:49502825-49502847 TGGGGAGGGTGGGCACATGACGG - Intronic
1137570994 16:49566225-49566247 TGGGGAGAGAGGCCTGGAGAGGG + Intronic
1137980085 16:53062035-53062057 TGGGGAGAGAGGGCAGCCCCAGG - Intronic
1138213641 16:55184050-55184072 TGGGGTGAGAGGGCTGGAGAGGG + Intergenic
1138350720 16:56344982-56345004 TGGGGACAGAGGACAGCAGGGGG + Exonic
1140051374 16:71484407-71484429 GGGGGAGCGAAGGCACCAGAGGG + Intronic
1140195720 16:72853685-72853707 TTGGAAGAGAGGGCAGTAGAAGG + Intronic
1140776066 16:78249862-78249884 AGGGGAGAAGGGGCACCAGAAGG + Intronic
1141448593 16:84080823-84080845 TGGGGAGTGAGGGCCTCTGAAGG - Intronic
1141638842 16:85329601-85329623 TGCGGGGAGAGGGCAGGAGAAGG + Intergenic
1142366325 16:89651827-89651849 CGGCGAGAGATGGCACCAGCTGG + Intronic
1142621291 17:1167163-1167185 CGGAGAGAGAGGCCACCAGTTGG + Intronic
1142759570 17:2034842-2034864 AGGGGAGGGAGGGCAGCAGCAGG - Intronic
1143149516 17:4798902-4798924 TGTGGAGAGAGGGGACCATGAGG - Intergenic
1143155543 17:4833806-4833828 TGGAGAGAGAAGGGAGCAGAGGG - Intronic
1143781281 17:9230881-9230903 TGGGGAGAGAGGGCTCTAAGGGG + Intronic
1144693081 17:17281454-17281476 TGGGGATAGTGGGCAAAAGAAGG + Intergenic
1144954337 17:19011619-19011641 TGGGCAGGGTGGGCCCCAGACGG + Intronic
1145240013 17:21235698-21235720 GAGGGAGAGAGGGCTCCAGGTGG - Intergenic
1145845304 17:28033457-28033479 AGGGGAGAGAGAGATCCAGAGGG + Intergenic
1145995984 17:29105286-29105308 TGGGCAGTGAGGGCAGCAGGAGG + Intronic
1146657946 17:34645940-34645962 TGGGGAGAGAGGAGAGGAGAAGG + Intergenic
1146821120 17:35984291-35984313 TGGGGGGAGAGGGAGCCAGCAGG - Intronic
1146945409 17:36870011-36870033 TGGGCAGAGAGTGCCCCAGTCGG + Intergenic
1147843556 17:43389312-43389334 CGGGGTGGGAGGACACCAGAGGG + Intergenic
1147884536 17:43675913-43675935 GGGGTACAGAGGGCAACAGAGGG + Intergenic
1148588784 17:48799926-48799948 TGGGGAGTGTGGGCTTCAGAGGG + Intronic
1148732095 17:49843499-49843521 TGGGGAGCACGGGCACCTGAAGG - Intronic
1148732467 17:49845859-49845881 TGGGGTGGGAGGGAAGCAGATGG - Intronic
1148772747 17:50076525-50076547 TGGGGCGAGAGGGCACTGGGGGG + Intronic
1149539157 17:57455669-57455691 AGGAGAGCGAGGGCAGCAGAGGG + Intronic
1149786663 17:59441257-59441279 TGGGGAGAGACAGCACCCCAGGG + Intergenic
1149992368 17:61390190-61390212 TGGGGAAATAAGGCAACAGAGGG + Intronic
1149992746 17:61391911-61391933 TGGGGAGTGGGGGCACCATCTGG - Intronic
1149994237 17:61398632-61398654 TGCGCACAGAGGGCACCACACGG + Intergenic
1151212450 17:72554774-72554796 TGGGGTGGGAGAGCTCCAGAAGG - Intergenic
1151505270 17:74523120-74523142 TGGGCAAAGAGGGTCCCAGAAGG - Intronic
1151553984 17:74837434-74837456 GGGGCAGCGAGGGCAGCAGACGG - Exonic
1151750133 17:76032482-76032504 AGGAGAGAGTGGGCACCAGAGGG - Intergenic
1152781025 17:82227516-82227538 TGAGGAGGGAGAGCAGCAGAGGG - Intergenic
1152881061 17:82815508-82815530 TGGGGACAGAGGGCACAGCATGG + Intronic
1153047376 18:869204-869226 TGGGGAGAAACGGCCCCAGTGGG + Intergenic
1153607498 18:6848859-6848881 TGGGGAGACTGGGAAACAGAAGG - Intronic
1157173398 18:45428675-45428697 TGGGTAGAGAGGTGAGCAGAAGG + Intronic
1157365583 18:47061347-47061369 TGGCAAGAGAGGGAACAAGAAGG + Intronic
1157493561 18:48139776-48139798 TGGGGAGAGAGGGCAAGGGGAGG + Intronic
1157535377 18:48453538-48453560 TGGGGAGAAAGGGCGGCAGAAGG + Intergenic
1158476343 18:57783251-57783273 AGGGGAAAGAGGGCATCTGATGG + Intronic
1160123942 18:76153674-76153696 TGGGTAGAGAAGGCAGCAGGCGG + Intergenic
1161089677 19:2353591-2353613 TGGGGAGGGAGGTCACCTGAAGG - Exonic
1161154700 19:2726619-2726641 AGGGGAGACTGGGCACTAGATGG + Intronic
1161496759 19:4590824-4590846 TGGGGGGAGAGGGAGGCAGAAGG - Intergenic
1161800921 19:6416393-6416415 TGGGCAGAGAGGACCCTAGAAGG + Exonic
1162431985 19:10634602-10634624 TGGGGAGAGAATGCACCGGGCGG + Intronic
1162457770 19:10796287-10796309 TGGGGAGAAAAGGCACCAGTGGG - Intronic
1162469706 19:10865108-10865130 TGGGGAGAGGGGGCATCACCAGG - Intronic
1163347524 19:16753138-16753160 TGTGCAGAGAGGACCCCAGAGGG - Intronic
1163518373 19:17778446-17778468 TGGAGAGGGAAGTCACCAGAAGG + Intronic
1164432049 19:28197276-28197298 TGTGCAGAGAGAGCACCAGGTGG - Intergenic
1164558011 19:29268431-29268453 TGGAGAGAGAGGGCGAGAGAGGG + Intergenic
1164598896 19:29548099-29548121 AGGGGAGAGAGGGCACAGCAGGG + Intronic
1164826377 19:31287639-31287661 GGGAGAGAGAGGCCACCAAAGGG + Intronic
1164876386 19:31693681-31693703 AGAGGAGAGAAGGCAACAGAAGG + Intergenic
1165745503 19:38228118-38228140 TAGGGTGAGAGGGCAGCAGAGGG + Intronic
1166567156 19:43772226-43772248 GGGGAAGGGAGGGAACCAGAGGG - Intronic
1166834519 19:45659180-45659202 TGGGGAGAGGGGGCACCCCGTGG - Intergenic
1167168177 19:47813564-47813586 GGGGCAGAGAGGGCACCTGGAGG - Intronic
1167384362 19:49155436-49155458 TGGGGAGGGAGGGCCCCAGAGGG - Intergenic
1167388782 19:49180764-49180786 TGGGGAGAGAGGAAACAAGATGG - Intronic
1167388994 19:49181923-49181945 TGGGGAGAGAGGAAACAAGATGG - Intronic
1167410221 19:49339835-49339857 TGGGGAGACAAGGCACCGCAGGG + Intronic
1167556233 19:50197659-50197681 AGGGGACAGAGGGGACCAGATGG + Intronic
925234403 2:2265529-2265551 TGGGTACAGAGGGGACCAGGCGG + Intronic
926004097 2:9358541-9358563 TGGAGAGAGAGGGAAGAAGAGGG + Intronic
926060792 2:9803453-9803475 TGGGGAGAGAGGGCCTCGAATGG - Intergenic
926337387 2:11874997-11875019 GGGGGAGAGAGGGGAGCGGACGG - Intergenic
926731288 2:16037639-16037661 TGGGGAGAGTGAGGTCCAGAGGG + Intergenic
927506808 2:23620218-23620240 TGGTGAGAGGGGGCACCAGGAGG + Intronic
927882370 2:26697764-26697786 TGGGGAAAGAGCGGAACAGAAGG - Intronic
928102298 2:28446113-28446135 GAGGGAGAGAGGGCTCCAGCTGG + Intergenic
929158797 2:38811392-38811414 TGGGAAGAGAGGGGCCCAGGAGG + Intronic
929410540 2:41693995-41694017 AGAGGGGAGAGGGCACCAGCTGG - Intergenic
930869486 2:56155439-56155461 AGGGGAAAGAGGGGACCAAAAGG + Intergenic
932183645 2:69672718-69672740 TGGGGAGAGAGGGAAGTAAATGG + Intronic
932768199 2:74484374-74484396 GTGGGAGAGAAGGCAGCAGATGG + Intronic
933983623 2:87573254-87573276 TGGGGAGAGAGCGGGCCACAAGG - Intergenic
935359601 2:102236302-102236324 GGGCGAGAGAGGGAGCCAGAGGG + Intronic
935549035 2:104432227-104432249 TGGGGGGAGTGGGGAGCAGAGGG - Intergenic
935590485 2:104843005-104843027 AAGGGAGAGAGGGCCACAGAGGG - Intergenic
935626700 2:105177629-105177651 AGGTGAGAGAGGGCAGCACAGGG + Intergenic
936008375 2:108909519-108909541 GGGGCACAGAGGCCACCAGAAGG - Intronic
936153500 2:110034023-110034045 GGGGGACAGAGGTCACCAAAGGG + Intergenic
936154612 2:110039963-110039985 TGGGGACAGAAGCCACCAGCAGG - Intergenic
936190071 2:110331451-110331473 TGGGGACAGAAGCCACCAGCAGG + Intergenic
936191181 2:110337392-110337414 GGGGGACAGAGGTCACCAAAGGG - Intergenic
936251955 2:110874111-110874133 TTGGGAGAGAGGGCAGCAAAAGG + Intronic
936310228 2:111377540-111377562 TGGGGAGAGAGCGGGCCACAAGG + Intergenic
936697377 2:114966438-114966460 TGGTGAGAGAGGAAACAAGAGGG - Intronic
936764702 2:115832744-115832766 TGTGGAGAATGGGCACCTGATGG - Intronic
937749795 2:125461577-125461599 TGGTGACAGAGGGCAAAAGAGGG + Intergenic
937827260 2:126380410-126380432 TGTGGAGGGAGGGCAGTAGAGGG + Intergenic
937969307 2:127536948-127536970 TGTGGAGAGGCGGCACCACAGGG + Intronic
938067983 2:128292210-128292232 TGGGGAGAGGGATCCCCAGAGGG + Intronic
938291070 2:130150812-130150834 TGGGGAGCGAGGGCAGCAGTGGG - Intergenic
938305876 2:130253691-130253713 AGGGGACAGCGGGCCCCAGATGG - Intergenic
938448278 2:131394080-131394102 AGGGGACAGCGGGCCCCAGATGG + Intergenic
938465481 2:131522147-131522169 TGGGGAGCAAGGGCAGCAGCGGG + Intergenic
938617783 2:133017731-133017753 TGGGGAGAGAAGGAAACAGTGGG - Intronic
940719640 2:157268039-157268061 TGGGGAGTGAAGGCCCCTGAAGG + Intronic
941016499 2:160363462-160363484 TGGGGAGGGGAGGCACCGGATGG + Intronic
943470998 2:188292910-188292932 TGGCGAGTGAGGCCACGAGAAGG - Exonic
944311124 2:198235084-198235106 TGGGGAGAGCAGGGACAAGAGGG + Intronic
945536679 2:211026295-211026317 TGGGGAGGGTGGGCACAAGTGGG - Intergenic
946134880 2:217637367-217637389 TGGGGAGACAGCCCACCCGAGGG + Intronic
946375811 2:219308501-219308523 TGGGGAAAGAGGGCGCCAGGCGG + Intronic
946755123 2:222936802-222936824 AGGGGAGAGAGGGAAGCAAAGGG + Intronic
947065211 2:226216821-226216843 CGGGGAGGGAGGGAAGCAGAGGG + Intergenic
947759487 2:232593417-232593439 TGGAGACAGAGGGCACAAGCTGG + Intergenic
947865876 2:233397500-233397522 CGAGGCGAGAGGACACCAGAGGG + Intronic
948345866 2:237297651-237297673 TGGGGAGGGAAGGCTCCACAGGG - Intergenic
948659879 2:239500490-239500512 TGGGCAGTCAGGGCAACAGAGGG + Intergenic
948835298 2:240623527-240623549 TGGGGAGAGAGGGGCCCTGGGGG + Intronic
948874199 2:240818667-240818689 TGGTGTGAGAAGGCAGCAGAGGG - Intronic
1170529491 20:17276660-17276682 TGGTGAGAGAGGGCATCACAGGG - Intronic
1170606444 20:17878383-17878405 TGAGCACAGAGGGCAACAGAGGG + Intergenic
1170672060 20:18443666-18443688 TACGCAGAAAGGGCACCAGAGGG - Intronic
1170950847 20:20934558-20934580 TGGCTAGAAAGGGCACAAGATGG + Intergenic
1171517846 20:25751605-25751627 TGTGGAGAGAGGACACCTGTAGG + Intergenic
1171867524 20:30498724-30498746 GAGGGAGAGAGAGAACCAGACGG + Intergenic
1171950771 20:31419714-31419736 GTGAGAGAGAGGGCACCAGGGGG - Intergenic
1172101058 20:32484044-32484066 TGGGGGGAGAGGGCACCCGGCGG + Intronic
1172491851 20:35345383-35345405 TCTGGAGAGAGGTCACCAGGTGG - Intronic
1172645377 20:36465879-36465901 GGGGAAGAGAGGGCACTATAGGG - Intronic
1172896304 20:38302788-38302810 CGGGGAGACAGGGCACTAGGGGG + Intronic
1173581868 20:44152682-44152704 GGGGGACACAGGTCACCAGAGGG - Intronic
1173841187 20:46158229-46158251 TGGGAAGAGGAGGCCCCAGAAGG + Intergenic
1174096503 20:48093530-48093552 TGGGGAGAGAAGGTGGCAGAGGG + Intergenic
1174097518 20:48101081-48101103 TGTGAAATGAGGGCACCAGAAGG - Intergenic
1174423488 20:50415969-50415991 TGGAGAGAGAAGGAAACAGAGGG + Intergenic
1174948251 20:55012759-55012781 TGGAGAGAGAGAGCATGAGAGGG + Intergenic
1175948212 20:62568503-62568525 AGGGGAGAGGGGGCAGCAGAAGG + Intronic
1176171045 20:63696524-63696546 TGGGGAGGGATGGTACCAGGTGG + Intronic
1176719101 21:10378996-10379018 GGGGGAGAGAGGGAGACAGAGGG - Intergenic
1178674969 21:34623192-34623214 TGGGGGGACAGGGCTCTAGATGG + Intergenic
1179707730 21:43192001-43192023 TGGTGAGAGAGGTCTCCAGCAGG - Intergenic
1179911235 21:44449974-44449996 TGTGGAGGCAGGGCAGCAGAGGG + Intergenic
1181037776 22:20178220-20178242 TGGGGAGCGTGGGCGCCCGAGGG - Intergenic
1181913085 22:26256077-26256099 TGAGAAGAGAGGGCAGGAGAAGG - Intronic
1182067815 22:27442909-27442931 TGGGAAGACAGGGTGCCAGAGGG + Intergenic
1183014685 22:34976465-34976487 TGTGGAGAGAGTGCCCCGGAGGG - Intergenic
1183520086 22:38291744-38291766 TGGGGGCAGCGGGCACCACAAGG + Exonic
1183592812 22:38790460-38790482 TGGGGAGAGGGGAAACCAGGTGG + Intronic
1183771239 22:39927749-39927771 TGGTGAGACAGGGCAGCACACGG - Intronic
1184137115 22:42555963-42555985 TGGGGGGGGGGGGCACCATATGG - Intronic
1184248528 22:43247737-43247759 TGGGGTGAGAGGGAGCCAGCGGG + Intronic
1184669120 22:46003598-46003620 TGGGGAGAGGGGACACAAGATGG - Intergenic
1184768517 22:46585085-46585107 TGGGAAGAGAGAGAACCAGGTGG + Intronic
1184852914 22:47131022-47131044 TGGCGAGAGAGGGAGCAAGAGGG + Intronic
949747147 3:7308285-7308307 TGGGGTGAGATGGCCACAGATGG - Intronic
949783412 3:7714937-7714959 TGGGAAGAGAAGCTACCAGATGG - Intronic
949788152 3:7764187-7764209 TGGGGAGTGAGGGTAACACAGGG - Intergenic
950213800 3:11143282-11143304 TGTGGAGAGTGGGCTGCAGAAGG + Intronic
950359667 3:12441349-12441371 TGGGGAGACAGGGGACACGAGGG - Intergenic
950421404 3:12901736-12901758 TGGGGAGTGAGGGCAGGGGAGGG + Intronic
950586201 3:13894463-13894485 TGGGGAGACAGGGCAACAGTTGG - Intergenic
950865907 3:16188872-16188894 TGGAGAGAGAGGACACAAGGAGG - Intronic
952880126 3:37979942-37979964 TGGGGAGAGAGTGGAGGAGAGGG - Intronic
953023890 3:39133890-39133912 TGGGGATACAGGGCACCACTTGG + Intronic
953439851 3:42907943-42907965 AGGGGAGACAGGGCATCAAAAGG - Intronic
953676856 3:45009440-45009462 TGGGGAGAGAGGACAACAAGAGG - Intronic
954127907 3:48543024-48543046 TGGGGACAGAGAACTCCAGAAGG + Intronic
954613591 3:51958607-51958629 GGGGGAGATGGGGCAACAGAGGG + Intronic
954674982 3:52310810-52310832 GGAGGACAGAGGGCACCACAGGG + Intergenic
955798876 3:62666021-62666043 TCAGAAGAGAAGGCACCAGATGG + Intronic
956795720 3:72716911-72716933 TGAGGAGATTGGGCCCCAGAGGG + Intergenic
958870392 3:99551738-99551760 AGGGCAGAGAGGCCACTAGAGGG + Intergenic
959210221 3:103369403-103369425 TGGGGAGAGAGAGAACCAACCGG + Intergenic
960144990 3:114191485-114191507 TGGGGAGAGAAGATGCCAGATGG + Intronic
960539593 3:118848696-118848718 GGGAGAGAGAGGGAAGCAGAAGG + Intergenic
960571515 3:119189293-119189315 TGAGTAGTGAGGGCAACAGAGGG + Intronic
960812306 3:121636632-121636654 TGGGAAGAGAGGGAAACAGATGG + Intronic
961333759 3:126158079-126158101 GGGACAGAGAGGGCACCAGGAGG - Intronic
961333766 3:126158106-126158128 GAGACAGAGAGGGCACCAGAAGG - Intronic
961339066 3:126205206-126205228 TGGGGAGAGGGAGCACCTGGGGG + Intergenic
961339138 3:126205460-126205482 TGGGGAGAGGGTGCACCTGGTGG + Intergenic
961722888 3:128907990-128908012 TGAGGAGGGAGGTGACCAGATGG - Intronic
962607375 3:137044187-137044209 TGGAGAGAAAGGGAACTAGAAGG + Intergenic
963133201 3:141876907-141876929 TGGGGTGAGCGGGCAGCAGCTGG + Exonic
963711972 3:148756491-148756513 TGGGGAAAGAGGCCACAGGAAGG - Intergenic
963734840 3:149008109-149008131 TGGTGGGAGAGTGCACCATAGGG + Intronic
963888175 3:150603730-150603752 TGGGGAAGGAGGGCGCGAGAAGG + Intronic
964848795 3:161071711-161071733 TAGGGAGAGAGAGCTCCAGAAGG - Exonic
966419811 3:179726338-179726360 TGGGCAGAGTGGGCACATGAAGG + Intronic
968075178 3:195812237-195812259 GGGGAAGAAAGGGCCCCAGAGGG + Exonic
968445560 4:650519-650541 TGGGCAGAGAGGGCCCAGGAAGG + Intronic
968635383 4:1675804-1675826 TGGGGAGCGAGGGGAGAAGATGG - Intronic
968682532 4:1931058-1931080 TGTGAAGAGAGGACACAAGAAGG + Intronic
968826339 4:2900451-2900473 TGGGGAAAGAAGGCCTCAGAGGG + Intronic
969516408 4:7650698-7650720 CGGGGAGAGAGGGCTGGAGAGGG - Intronic
969583963 4:8081336-8081358 AGGACAGAGAGGGCACCAGGAGG - Intronic
969695319 4:8730928-8730950 TGGGGAGGGAGGGAACCTGGCGG + Intergenic
969697789 4:8744928-8744950 AGGGGAGAGATGGCACAGGAGGG - Intergenic
970402918 4:15735205-15735227 CAGGGAGAGAGGTCAACAGAAGG - Intronic
970528658 4:16959345-16959367 TAAGGAGAGAGGGCAACAGTAGG + Intergenic
972379432 4:38505387-38505409 TGGGGAGAGAGGGGAAAAAAGGG - Intergenic
972801192 4:42477486-42477508 TGGGGAGAGAGAGAAAGAGAGGG - Intronic
975399121 4:73914163-73914185 TGGGCAGAGAAGGCTTCAGATGG - Intergenic
975529536 4:75386166-75386188 TGGGGAGAGAAGGCAGAAGCTGG - Intergenic
975702080 4:77075979-77076001 TGGGGAGGGAGGGGAAGAGAGGG + Exonic
977516468 4:98026452-98026474 TGGCAAGAGAGGGCACCAGATGG + Intronic
980005985 4:127542865-127542887 TAGGGAGAGGGGGCACAAGAAGG + Intergenic
981272484 4:142860867-142860889 TGGGGAGATAGGGGCCTAGATGG - Intergenic
981550691 4:145938033-145938055 TGGGGGGAGGGGGCAAGAGAAGG - Intronic
985300851 4:188487765-188487787 TTGGGTAAGAGGGTACCAGATGG + Intergenic
985869692 5:2544651-2544673 GGGGCAGAGAGGAAACCAGAGGG + Intergenic
985904463 5:2822795-2822817 TGAGGAGAGCAGGTACCAGATGG - Intergenic
986972743 5:13355931-13355953 TGGAGATGGAGGGAACCAGATGG + Intergenic
988079075 5:26392915-26392937 TGGTGAGAGAGGGAACAGGAGGG + Intergenic
992084137 5:73262884-73262906 TGGGGAGACAGTGCAACAGGGGG - Intergenic
992527864 5:77629821-77629843 TGGGGAAAGAGGGGACCGGAGGG + Exonic
992691452 5:79244418-79244440 TGGGGAGAGAAGGGAGAAGATGG + Intronic
992786338 5:80173851-80173873 TGGGATGGGAGAGCACCAGAGGG - Intronic
993478077 5:88389357-88389379 TTGGGAGAGTGTGCACAAGATGG - Intergenic
993641233 5:90409066-90409088 TAGTGGGAGAGGGCAACAGAGGG + Intronic
994868281 5:105308382-105308404 TGGGGTGAGAGGGCATTAAATGG - Intergenic
995054902 5:107748148-107748170 TGGGGAGTGAGGGGAACAAATGG - Intergenic
995457567 5:112368369-112368391 AGGGGAGAGGGGACAACAGATGG - Intronic
996338355 5:122409167-122409189 TGGGAAAAGAGGACACCACAAGG + Intronic
996347395 5:122501797-122501819 TGAGGAGGGAGAGCACCAGAAGG + Intergenic
997242890 5:132321017-132321039 TGAGCAGAGATGGCACCAGATGG - Intronic
997735863 5:136212358-136212380 TGGGGAGAGCAGCCACCAGAGGG - Intergenic
998385527 5:141755027-141755049 TGGGGAAGGAGGGCAGCAGCTGG + Intergenic
999151805 5:149431241-149431263 TGGGTAGAGATGCCACAAGAGGG - Intergenic
999195302 5:149777683-149777705 TGGGGAGAGAGGACCAAAGAAGG - Intronic
999779903 5:154840924-154840946 TGAGGAGTTAGGACACCAGAAGG + Intronic
1001265888 5:170274412-170274434 TGGTGAGGGAAGGCATCAGATGG - Intronic
1001790011 5:174448113-174448135 GGGGAAGGGAGGGCATCAGAGGG - Intergenic
1002132423 5:177089728-177089750 TGGGAAGAGTGGGCACCAGGAGG + Intronic
1002876547 6:1215763-1215785 TGGGGATGGAGGGCTCCAGGAGG + Intergenic
1003145099 6:3503940-3503962 TCGGTGGAGAGGGAACCAGAGGG + Intergenic
1003646987 6:7920902-7920924 AGGAGAGAGAGGGGCCCAGAGGG + Intronic
1004105255 6:12661391-12661413 TGGGGTGAGAGGGGGGCAGAGGG - Intergenic
1004286170 6:14322799-14322821 TGGGGAAAGGGGACTCCAGAGGG + Intergenic
1004510051 6:16277887-16277909 TGGGGAGGGAGGGGAGCAGGTGG + Intronic
1005079517 6:21942892-21942914 TGGTGAGAGAGGCCATCTGAAGG - Intergenic
1005115349 6:22329846-22329868 TGGAGAGAGAAGGCAGAAGACGG - Intergenic
1005224869 6:23630865-23630887 TGGGGAGAGATTGCCCCAGATGG + Intergenic
1005751599 6:28887991-28888013 TTGAGAGAAAGGGAACCAGATGG - Intergenic
1006058417 6:31402669-31402691 TGGGGAAAGAGGAAATCAGAAGG + Intronic
1006116240 6:31777475-31777497 GGGGCAGAGAGGGGAGCAGAGGG - Intergenic
1006267660 6:32938660-32938682 TGAGGAGAGAGGGGTGCAGAGGG - Intronic
1006317418 6:33298766-33298788 TTGGGGGAGGGGGCAACAGAAGG + Intronic
1006339473 6:33438751-33438773 TGGGGGGTGGGGGCACAAGAGGG - Intronic
1006689329 6:35867206-35867228 CGGGGAGCAAGGGCAGCAGAAGG + Intronic
1007295322 6:40816705-40816727 TGGGCATCCAGGGCACCAGAAGG + Intergenic
1007501036 6:42297057-42297079 TGGGGAGAGAGGAGAGGAGAGGG + Intronic
1007852087 6:44812944-44812966 TGGGGGGTGAGAGCAGCAGACGG + Intronic
1008011104 6:46468719-46468741 AGGGGAGAGAGGGAATCTGAGGG - Intronic
1008028638 6:46667746-46667768 AGGGGACAGAGAGTACCAGAGGG - Intronic
1008556655 6:52679175-52679197 TGGGGAGAGAGGGCAGCCAGTGG + Intronic
1009836789 6:69011478-69011500 TGGGGAGGGAGGGAAGGAGAGGG + Intronic
1010568479 6:77448351-77448373 TTGGGAGAGGGTGCACAAGAAGG + Intergenic
1010727748 6:79354550-79354572 AGGGGAGAGAAGGTACCAAAAGG - Intergenic
1011559401 6:88599564-88599586 CGGGAAGGGGGGGCACCAGAGGG + Intergenic
1011781935 6:90799386-90799408 CGGTGAGAGAGGGAACAAGAGGG + Intergenic
1011821830 6:91262103-91262125 TGGTGAGAGAGGGGACAAGAGGG + Intergenic
1012663621 6:101937350-101937372 TTAGGAGAGAGGGCCCCACAGGG + Intronic
1013478327 6:110530017-110530039 AGTGGAGAGAGGGCAGCAGCAGG + Intergenic
1014156002 6:118110452-118110474 TGGGGACAGAGGGCACTATTTGG + Intronic
1015599235 6:134896199-134896221 TGGAAAGAGAGGCCACCTGAGGG + Intergenic
1017649060 6:156564550-156564572 GATGGAGAGAGGCCACCAGAGGG + Intergenic
1018203483 6:161415827-161415849 TGGGGAGAGAGGGACGCAGTGGG - Intronic
1018835754 6:167482482-167482504 TGGGGAAGGAGGACACCAGGAGG + Intergenic
1018996239 6:168712389-168712411 TGGGGAGTCAGGGGACAAGAGGG + Intergenic
1019198550 6:170296306-170296328 CGGGGAGTGAGCGCACCTGAGGG + Intronic
1019362871 7:614511-614533 TTGGGAGACCGGGCACCATAAGG + Intronic
1019432686 7:1006825-1006847 TGGGGAGAGGAGGGTCCAGAGGG - Intronic
1020260823 7:6529911-6529933 TGGGGAGAGAGGACCCTAGGAGG - Intronic
1022375400 7:29806950-29806972 TGGGGAGCGAGGTCACCACGGGG + Intronic
1022735864 7:33075472-33075494 TTGGTACAGAAGGCACCAGAAGG + Intergenic
1023680935 7:42686291-42686313 TGGGGGGAGAGGGGAGGAGAAGG + Intergenic
1023789988 7:43746280-43746302 TGGGGAGAAGGGGCTGCAGAAGG + Intergenic
1024403757 7:48953773-48953795 GGTGGAGAGAGGGAATCAGAAGG - Intergenic
1024666500 7:51552001-51552023 TGTGGAGGGAGGGACCCAGAGGG + Intergenic
1024920085 7:54546032-54546054 GGGGGAGAGAGGGCACAGAAGGG + Intronic
1024944950 7:54799169-54799191 TGGGGAGTGAGGGGAGCAGCTGG - Intergenic
1025762078 7:64404709-64404731 AGGAAAGAGAGGGCACAAGATGG - Intergenic
1026472143 7:70702784-70702806 TGGTCAGAGAGGGCTCCAGGTGG - Intronic
1027048110 7:75004413-75004435 GGGGGAGAGAGGCCACCTCATGG + Intronic
1027137191 7:75633011-75633033 TGGGGAGGGAGAGCATCAGGAGG + Intronic
1027548235 7:79557512-79557534 TGGGGAGAGTAGGAGCCAGAGGG + Intergenic
1028017524 7:85734689-85734711 ATGGGAGAGAGGGTATCAGATGG - Intergenic
1028618551 7:92798753-92798775 TAGGAAGAGAGGGCAGGAGAAGG - Intronic
1028855212 7:95584303-95584325 TAGGAAGAGAGGGAAGCAGAAGG - Exonic
1028920693 7:96307030-96307052 TAGGGAGAGAGGCTACCTGAGGG - Intronic
1029252565 7:99247535-99247557 TGGGGGAAGAGGGTACCAGGAGG + Intergenic
1029384891 7:100237202-100237224 GGGGGAGAGAGGCCACCTCATGG - Intronic
1029438894 7:100576828-100576850 TTGGGAGAGAGGGACACAGAGGG - Intronic
1029647979 7:101869973-101869995 TGGGGAGGGAAGGCACAAGAGGG - Intronic
1030999226 7:116395684-116395706 AGGGAAGAGAGGGCAGGAGAGGG - Intronic
1031506978 7:122596996-122597018 TGGGGAGAGAGGACACAAGAGGG + Intronic
1031999064 7:128253031-128253053 TGGGGACAGAGGGGACAGGAAGG - Intronic
1032014655 7:128370678-128370700 GGGGGAGGGAGAGCACCAGGTGG + Intergenic
1033595625 7:142856030-142856052 GGAGGAGAGAGGGTGCCAGACGG - Intronic
1034198200 7:149263940-149263962 TGGGAAGAGGGGGCCCTAGAAGG + Intronic
1034217295 7:149418141-149418163 ATGGGAGGGAGGGCACAAGAAGG - Intergenic
1034339345 7:150341765-150341787 TGGGGAGGGAGGGCGCGGGAGGG - Intergenic
1034430089 7:151036796-151036818 TGGGGAGAGAGAGCCCCTCAGGG + Intronic
1034471192 7:151255213-151255235 TGGGGAGAGATGGCAACTGTAGG - Intronic
1034534954 7:151720793-151720815 AGGGGAGAGAGGGCAATGGAGGG + Intronic
1034814983 7:154164250-154164272 GGGGGAGAGAGGGAAAGAGAAGG - Intronic
1034881195 7:154763918-154763940 TGGGTAGAGAGGGCACCAAGAGG - Intronic
1035186638 7:157131475-157131497 TGTGGAGGGAGGGAACCTGAGGG - Intergenic
1036222673 8:6933896-6933918 GGGGGATAGAGGTCACCAGGGGG + Intergenic
1036546219 8:9771910-9771932 TGGGGAGAGAGGGAGGAAGAGGG + Intronic
1037150103 8:15626355-15626377 TGGGCAGAGAGGGGACCCCAAGG + Intronic
1037648436 8:20815153-20815175 TGGGGAGAGAGGATTCCAGTGGG - Intergenic
1037782676 8:21881476-21881498 TGAGAAGAGAGGGGACAAGAAGG + Intergenic
1037822657 8:22142358-22142380 TGGGGGGAGAGGGAACCTGAGGG + Intergenic
1037946433 8:22992535-22992557 TAGGCAGAGAGGGTACAAGAGGG - Intronic
1038452800 8:27650720-27650742 GGAGGAAAGAGGGAACCAGATGG - Intronic
1038871280 8:31496597-31496619 TGGGTAGAGAGGGAAGCAAAGGG - Intergenic
1038922151 8:32096664-32096686 TGGTGAGAGAGGAAACAAGAAGG + Intronic
1039456800 8:37712603-37712625 TGGGAAGACAGGGAAACAGAAGG - Intergenic
1039466508 8:37788818-37788840 TAGGGAGAGGGGGCGACAGAGGG - Intronic
1039912116 8:41834047-41834069 GAGGGTGAGAGGGCACCAGATGG + Intronic
1040630074 8:49200000-49200022 TGGTGAGAGAGGGCATCCTATGG - Intergenic
1041004994 8:53488918-53488940 TGGTGAGAGTGGGAGCCAGATGG - Intergenic
1041060907 8:54033499-54033521 TGGTGAGAGAGGGAACAAGCAGG + Intergenic
1041205021 8:55490408-55490430 AGGGGAGAGAGGGAAGGAGAGGG + Intronic
1043403850 8:79910876-79910898 TGGCGAGAGATGTCACAAGATGG - Intergenic
1044600143 8:93995764-93995786 TGGGAAGGGAGGGCAGAAGAAGG - Intergenic
1044821945 8:96160881-96160903 TGGGGAGGGAGGGCAGAGGAGGG + Intergenic
1045482051 8:102600661-102600683 CGGGAAGAGGTGGCACCAGAGGG - Intergenic
1046257508 8:111720911-111720933 AGGAGAGAGAGAGAACCAGAAGG + Intergenic
1046599104 8:116297048-116297070 AGGGGAGAGGGAGCATCAGAGGG - Intergenic
1047541282 8:125768791-125768813 TGGGGAGGGAGCGCTCCAGTTGG + Intergenic
1047655577 8:126973406-126973428 TGAGGAGAGAGTGCACCCCATGG + Intergenic
1048339833 8:133529900-133529922 TGGGGAGTGCTGGCAGCAGAGGG - Intronic
1048523395 8:135178529-135178551 TGGTGAGAGAGAACACCAAATGG - Intergenic
1048708185 8:137178184-137178206 TTGGGGGTGAGGGCAGCAGAAGG + Intergenic
1049225752 8:141449753-141449775 TGGGCAGAGAGGGCATGTGAGGG + Intergenic
1049483949 8:142841732-142841754 TGGGGAGAGAGGGCACCAGAGGG - Intronic
1049560446 8:143307534-143307556 GTGGCAGAGAGGGCAGCAGAGGG + Intronic
1049932655 9:471399-471421 TGAGGAGAGAGGTCAAGAGATGG + Intronic
1050380335 9:5021324-5021346 TGGGGGAAGAGGGGTCCAGAAGG - Intronic
1050629265 9:7541609-7541631 TGGGGAGAAAGAGCAAGAGACGG + Intergenic
1052695105 9:31868705-31868727 GCTGGAGACAGGGCACCAGATGG + Intergenic
1053042489 9:34886274-34886296 AGGGGAGAGTGGGATCCAGAAGG - Intergenic
1053131745 9:35619256-35619278 GGAGGAGAGAGGGAACCAGTTGG + Intronic
1053167460 9:35854478-35854500 TGGGGAAAGAGGGCCCCTCAGGG + Exonic
1053433348 9:38058517-38058539 AGAGCAGAGAGGGCACCAGCAGG - Intronic
1053439473 9:38104391-38104413 TGGGCACAGCGGGCACTAGAGGG + Intergenic
1053504502 9:38629980-38630002 TGGGGAGCGAGAGCTGCAGAAGG - Intergenic
1053622501 9:39834452-39834474 TGGGGTGAAAGGGCATTAGAAGG - Intergenic
1053882360 9:42608628-42608650 TGGGGTGAAAGGGCATTAGAAGG + Intergenic
1053890309 9:42685665-42685687 TGGGGTGAAAGGGCATTAGAAGG - Intergenic
1054221385 9:62416096-62416118 TGGGGTGAAAGGGCATTAGAAGG + Intergenic
1054229329 9:62493077-62493099 TGGGGTGAAAGGGCATTAGAAGG - Intergenic
1056383207 9:86074476-86074498 GGGGGATAGAGGAAACCAGATGG - Intronic
1056540150 9:87564081-87564103 TGTGTATGGAGGGCACCAGAGGG - Intronic
1056957904 9:91097145-91097167 TGGGGGAAAAGGGCACCAGTGGG - Intergenic
1057210068 9:93196213-93196235 TGGGGAGAGTGAATACCAGAGGG - Intronic
1057315152 9:93963617-93963639 TGAGCTGAGAGGGCACCAGTGGG - Intergenic
1057595080 9:96409092-96409114 TGGTGAGAGAGGGAACAAGAGGG - Intronic
1058634627 9:107024379-107024401 TGGGGAGAGATGGAACTGGAGGG - Intergenic
1059469251 9:114491899-114491921 GGAGGAGAGAGGCCACCTGATGG - Intronic
1060102964 9:120856482-120856504 CGTGGAGGGTGGGCACCAGATGG - Exonic
1061061119 9:128250893-128250915 TGGGGCGCGAGGGCACCTGAGGG - Exonic
1061177947 9:129008722-129008744 TGGCGAGAGAGGCAACAAGAAGG - Exonic
1061750192 9:132771736-132771758 TGTGGTGTGAGGTCACCAGAGGG + Intronic
1061770508 9:132916773-132916795 CAGGGAGAGAGTGCTCCAGAAGG - Intronic
1061870924 9:133520071-133520093 TGGGGATAGAGGGCTGCAGCGGG + Intronic
1061937265 9:133864692-133864714 AGGGGACAGAGGGCCCCAGCGGG - Intronic
1062695480 9:137873674-137873696 GGGGGACAGGGGGCAGCAGAAGG + Intergenic
1186200923 X:7153973-7153995 GAGGGAGAGAGGGCAGGAGAGGG - Intergenic
1187305785 X:18094055-18094077 AGGGAAGAGAAGGCAGCAGAGGG - Intergenic
1187528142 X:20072385-20072407 TGGCGAGAGAGGGCATCGGGAGG - Intronic
1188103833 X:26124405-26124427 TGGTGAGAGAGGGTGCAAGAGGG - Intergenic
1188677925 X:32965612-32965634 TAGGTAGAGAGGAAACCAGATGG + Intronic
1189237753 X:39501281-39501303 TGTGGAGAGAGCCAACCAGATGG - Intergenic
1190027717 X:46941078-46941100 TGGGGAGAGAGGGAAGAGGAAGG - Intronic
1190037047 X:47035130-47035152 TGGGGAGAGAGGGCATGAGTGGG - Intronic
1190417958 X:50199766-50199788 TGGGGAGAGAGGGGAGGGGAAGG - Intronic
1190732112 X:53233297-53233319 TGGGGAGAGAGGCTCCCAAAGGG - Exonic
1190897980 X:54639897-54639919 AGGGGATGGAGGGCCCCAGAAGG + Intergenic
1192167890 X:68837350-68837372 TGGGGAGACAAGGCAGCACATGG - Intronic
1192229997 X:69257924-69257946 TGGGGTGGGAGGTCCCCAGATGG + Intergenic
1192422423 X:71045576-71045598 AGGGGACAGGTGGCACCAGAAGG - Intergenic
1195719492 X:107852813-107852835 GGGGGAGAGAGGGAACATGAAGG - Intronic
1196712763 X:118780615-118780637 TGGTGAGAGTGGGAACAAGAGGG + Intronic
1196755224 X:119151464-119151486 TGGAGGGAGAGGGGAGCAGAGGG + Intergenic
1197865009 X:131008229-131008251 TGCTGAGAGAGGCTACCAGAGGG + Intergenic
1198284006 X:135171753-135171775 TGTGGAGAGAGGGCATCATGTGG + Intergenic
1198286369 X:135195259-135195281 TGTGGAGAGAGGGCATCATGTGG + Intergenic
1198380259 X:136076981-136077003 TGGGGAGAGAGGACATCAAGTGG - Intergenic
1200223327 X:154402899-154402921 TGAGGAGGGAGGGCAGCAGCAGG - Intronic
1201596948 Y:15680757-15680779 GGGGGAGAGAGAGCTGCAGAGGG + Intergenic