ID: 1049483950

View in Genome Browser
Species Human (GRCh38)
Location 8:142841733-142841755
Sequence CTGGGGAGAGAGGGCACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 1, 2: 4, 3: 66, 4: 589}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049483950_1049483962 10 Left 1049483950 8:142841733-142841755 CCTCTGGTGCCCTCTCTCCCCAG 0: 1
1: 1
2: 4
3: 66
4: 589
Right 1049483962 8:142841766-142841788 TGCAGAAGATGTATGGCCAGAGG No data
1049483950_1049483963 25 Left 1049483950 8:142841733-142841755 CCTCTGGTGCCCTCTCTCCCCAG 0: 1
1: 1
2: 4
3: 66
4: 589
Right 1049483963 8:142841781-142841803 GCCAGAGGCCCAGTGACCAATGG No data
1049483950_1049483960 3 Left 1049483950 8:142841733-142841755 CCTCTGGTGCCCTCTCTCCCCAG 0: 1
1: 1
2: 4
3: 66
4: 589
Right 1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049483950 Original CRISPR CTGGGGAGAGAGGGCACCAG AGG (reversed) Intronic
900135465 1:1115527-1115549 TGGGGGAGAGGGGGCACCTGGGG - Intronic
900511628 1:3063552-3063574 CTGCGGAGAGACGGCAGGAGCGG + Intergenic
900603710 1:3514699-3514721 TTGGGGAGAGGGGACCCCAGTGG + Intronic
900612469 1:3549983-3550005 CTGGGGAGAGCGGGGACCCCTGG - Intronic
900833760 1:4984560-4984582 CTGAGGAGGAAAGGCACCAGAGG + Intergenic
900931652 1:5741846-5741868 CTGGGGGAAGTGGGCAGCAGGGG + Intergenic
900981209 1:6047359-6047381 CTGGGGACAGAGGACACCTCTGG - Intronic
901153330 1:7119206-7119228 TTGGGGAGAGACTGCACCAAAGG - Intronic
901447869 1:9319227-9319249 CTGGGAAGTGGGGGGACCAGGGG + Intronic
901614911 1:10530991-10531013 CTGGGGAGGGAAGGAAGCAGCGG - Intronic
901749292 1:11396184-11396206 CTGAGCAGAGTGGGCCCCAGAGG - Intergenic
901781316 1:11596678-11596700 GTGGGGTGAGAGGGGTCCAGTGG - Intergenic
902249801 1:15146866-15146888 CTGGGGACAGAGGGGCCCAAAGG - Intergenic
902377838 1:16038408-16038430 GTGGGGAGGGAGGGCCCCAGGGG + Intergenic
902382986 1:16061324-16061346 GTGGGGAGGGAGGGCCCCAGGGG + Intronic
902942652 1:19811764-19811786 ATGGGAACAGAGAGCACCAGAGG - Intergenic
903474113 1:23607627-23607649 ATGGGGAAAGAGGGCAGAAGGGG - Intronic
903650599 1:24919345-24919367 CTGGGGAGAGTGGGGAATAGAGG + Intronic
903857493 1:26345519-26345541 CCGGGGTGAGTGGGCACCACAGG + Exonic
904029623 1:27526049-27526071 CTGGGGTCAGAGGGCCCTAGTGG - Intergenic
904086800 1:27915078-27915100 CTGGGGAGAATCGGCACCATTGG - Intergenic
904997119 1:34639815-34639837 CTGGGGGGCGGGGGCACCATTGG - Intergenic
905289381 1:36911115-36911137 CTGGGGAGAGAGGGAGGGAGGGG + Intronic
906200540 1:43957379-43957401 CTGGGGAAAGAGGGTGCCACTGG - Intronic
906792905 1:48674311-48674333 CTGGGGAGAATGAGGACCAGAGG + Intronic
906995642 1:50790624-50790646 GTGGGGAGAGAGAGAACCATAGG + Intronic
907311876 1:53543445-53543467 CTGAGGAGTGAGAGCAGCAGTGG + Intronic
907520710 1:55021717-55021739 CTGGGAAGAGAGGGGAGGAGAGG + Intergenic
908021538 1:59903329-59903351 ATGTGGGGAGAGGGCACTAGAGG + Intronic
910240486 1:85080588-85080610 CTGGTAAGAGAGAGCAGCAGGGG + Intronic
910504674 1:87936207-87936229 CTGGAGGGATAGGGCAACAGGGG + Intergenic
911059473 1:93735182-93735204 CAGGCCAGAGGGGGCACCAGAGG - Intronic
911065310 1:93782525-93782547 CTGGGTAGAGAGGGCTACAGAGG + Intronic
912077304 1:105891486-105891508 CTGGTGAGAGGTGGCAGCAGCGG - Intergenic
912379093 1:109237221-109237243 CTGGGAAGACAGGGTCCCAGAGG - Intronic
912811997 1:112801912-112801934 CCTGGGAGAAAGGGCACAAGTGG - Intergenic
913203826 1:116517437-116517459 CTGAGGAGAAAGGACACCTGTGG + Intronic
914226070 1:145720696-145720718 CTGGGGAGGGTGGGGACAAGAGG - Intronic
914516660 1:148379919-148379941 GTGGGGAGGGAGGGCAGGAGCGG + Intergenic
914755601 1:150560037-150560059 CTGGGGACAGAGGAGGCCAGTGG - Intronic
914957178 1:152173227-152173249 CTGGGTGGGGGGGGCACCAGAGG + Intergenic
915128942 1:153683913-153683935 CAGGGGTGAAGGGGCACCAGGGG + Intronic
915549375 1:156623784-156623806 CTGGGCAGAGGGGGCCACAGTGG - Intronic
915573427 1:156758937-156758959 CAGGAGAGAGAGGACAGCAGCGG + Intronic
915724434 1:158007625-158007647 CTGGGGGGAGAGTGCAGCATGGG + Intronic
916048680 1:161019871-161019893 CTTGGGAGAGATTGGACCAGAGG - Intronic
916211151 1:162360934-162360956 CTGGAGAGTGAGGGCGCCAATGG + Intronic
917451143 1:175148392-175148414 CTGGGGAAGGAAGGCACCAGAGG - Intergenic
917968640 1:180193873-180193895 ATGGTGAGAGAGGTCAGCAGGGG - Intronic
919810982 1:201408688-201408710 CTGGGCAGAAGGGGCCCCAGGGG + Exonic
919924419 1:202185071-202185093 CTGGGCAGAGAAGGCACCAAGGG + Intergenic
919986434 1:202679056-202679078 CAAGGGAGAGAGGGCAGAAGGGG - Intronic
920084565 1:203405896-203405918 CTGTGCAGAGAGGGCAGCACAGG - Intergenic
920295557 1:204954165-204954187 CTGTGGAGAGTGGGGAGCAGTGG - Intronic
920652562 1:207849823-207849845 CTGAGGAGAGAGGGGAGCAGTGG + Intergenic
921217905 1:212952223-212952245 CTGGGGGAAGAGGGGAGCAGAGG - Intronic
921304016 1:213778083-213778105 CTGAGGGGAGAGGGCAGCTGTGG - Intergenic
921326472 1:213989533-213989555 CTGGGGAGGGAGGACAGGAGAGG + Intronic
921604578 1:217138434-217138456 CTGGGGAGACAGGACACCGAGGG + Intergenic
922261429 1:223948750-223948772 CTGGTGAGGGAGGTGACCAGTGG + Intergenic
922404617 1:225298934-225298956 CAGGGGAGACAGGGCTGCAGAGG + Intronic
922509662 1:226153500-226153522 CTAGTCAGAGAGGCCACCAGAGG - Intronic
922735645 1:227976993-227977015 CTGGTGAGGGAGGTGACCAGTGG - Intergenic
923238853 1:232061145-232061167 CTGGGGAGAGAGGGAGCAACAGG - Intergenic
923285182 1:232487444-232487466 CTGGGGTGAGAGGACAAGAGGGG + Intronic
923501705 1:234570733-234570755 CTTGGGAAAGAGGCCAGCAGAGG - Intergenic
924436394 1:244047983-244048005 CTGGAGAGGCAGGGCACCCGGGG - Intergenic
1063177720 10:3567462-3567484 CTGTGGAGACAGGGGAACAGGGG + Intergenic
1064256039 10:13743461-13743483 CTAGGGAGAGAGGGTCCCTGGGG + Intronic
1065818768 10:29506595-29506617 CTGGGGAGACAAGGCCCTAGAGG + Intronic
1066733882 10:38454625-38454647 CTGGTGAGGGAGGTGACCAGTGG - Intergenic
1067158087 10:43799605-43799627 CTGGGGAGGGATGGGAGCAGAGG + Intergenic
1067376653 10:45733430-45733452 CTGGGGAGACAGGGTAAAAGGGG - Intronic
1067476976 10:46573836-46573858 GTGGAGAGAGAGGGCGGCAGAGG - Intergenic
1067617763 10:47767945-47767967 GTGGAGAGAGAGGGCGGCAGAGG + Intergenic
1067757029 10:49012881-49012903 CTGCAGAGAGAAGGAACCAGAGG + Intergenic
1067884347 10:50074121-50074143 CTGGGGAGACAGGGTAAAAGGGG - Intronic
1069774247 10:70917653-70917675 CCAGGGAGAGAGGGCCTCAGTGG + Intergenic
1069865366 10:71499243-71499265 CTGGGGAGAGAGTGAAAGAGGGG + Intronic
1069874311 10:71552308-71552330 CTGGAGGGACAGGGCAACAGGGG + Intronic
1069903501 10:71719334-71719356 CTGGGGCCAGGGTGCACCAGCGG + Intronic
1070182761 10:74030167-74030189 CTGGGGAGTGATGGCAACTGTGG + Intronic
1070732594 10:78841705-78841727 GTGGGGAGAGAGGCCAGCAAGGG + Intergenic
1071113909 10:82194666-82194688 CTGCTGTGAGAGGGCACCGGTGG + Intronic
1071387758 10:85139564-85139586 CTGGAGAGAGAGGGTAACAGAGG + Intergenic
1071505728 10:86230276-86230298 CGGAGGAGAGAGGCCACCACAGG + Intronic
1071882682 10:89916658-89916680 ATGGGTAGAGAGGGCAAGAGAGG - Intergenic
1072691549 10:97575285-97575307 GAGGGGAAAGAGGGCCCCAGAGG + Intronic
1073094515 10:100971567-100971589 CCTGGGAGAGGAGGCACCAGTGG + Intronic
1073119763 10:101114406-101114428 CTGGGGGGAGGGGGGCCCAGAGG - Intronic
1073474047 10:103741434-103741456 CAGGGGAGAGAGGGCCAGAGTGG - Intronic
1074790478 10:116881601-116881623 GTGGGGAAGGTGGGCACCAGCGG - Exonic
1074883763 10:117679004-117679026 CTGGGGAGAGTGGCAACCAGGGG - Intergenic
1075058976 10:119241362-119241384 CTGGGAAGAGAGTGCACTAAAGG - Intronic
1075132134 10:119748962-119748984 CGTGGGAGAGAGGCCAGCAGGGG - Intronic
1075153490 10:119955666-119955688 GTGGGGAGAGAGGACAGCAGGGG + Intergenic
1075330818 10:121572764-121572786 CTGGGGAGAGAGAGAAACTGAGG + Intronic
1076106460 10:127827416-127827438 CTGAGGGTAGAGGGAACCAGGGG + Intergenic
1076190191 10:128477456-128477478 CTTGGGAGATTGGGCACCACTGG + Intergenic
1076249069 10:128970805-128970827 CTGGGGAGGGAAGGCAACCGAGG - Intergenic
1076419818 10:130323252-130323274 GTGGTGAGGGAGGGCACAAGTGG - Intergenic
1076468652 10:130703310-130703332 CTGGGGAGAGATGGCATGACTGG - Intergenic
1076700437 10:132270076-132270098 CAGGGGACTGAGGGCAGCAGGGG + Intronic
1076735615 10:132457684-132457706 CTGGGGAGGGAGGGCAGGGGAGG + Intergenic
1076808043 10:132869145-132869167 CTGGGGAGAGTGAGCACTTGGGG - Intronic
1076856203 10:133116581-133116603 CTGGGGGGAGAGGACGCCTGTGG - Intronic
1077074427 11:694094-694116 CTGGGGTGGGTGGGCACCTGTGG - Intronic
1077109955 11:857986-858008 AGGGGCAGACAGGGCACCAGGGG - Intronic
1077271977 11:1685679-1685701 CAGAGGAGAGAGGGCACTGGGGG - Intergenic
1077747878 11:4927818-4927840 CTGAGGACAGAGGTCACAAGAGG + Intronic
1078159233 11:8826565-8826587 CTGGGGAGAGAGAAGAGCAGTGG + Intronic
1080283862 11:30586277-30586299 CTGGGGAGAGAGCGAGCGAGGGG + Intronic
1081645356 11:44786365-44786387 CTGGGGACAGAGGGTAGAAGAGG + Intronic
1081740730 11:45438040-45438062 CTTGGGAGAGAAATCACCAGAGG - Intergenic
1082262755 11:50089933-50089955 CTGTGTGGAGAAGGCACCAGGGG - Intergenic
1082683497 11:56209173-56209195 CAGGGGAGAGAGGGAAGAAGAGG + Intergenic
1082959963 11:58909234-58909256 CTGGGAAGAGAGGAAAACAGAGG + Intronic
1083025592 11:59548057-59548079 ATGAGCAGTGAGGGCACCAGAGG + Intergenic
1083162992 11:60867217-60867239 CTGGGGTGAGAGGGAGACAGTGG + Intergenic
1083316163 11:61816171-61816193 CTGGGGAGGGAGGGGGTCAGTGG - Intronic
1083615223 11:64022778-64022800 CTGGGGAGCCAGGGGAGCAGGGG + Intronic
1083815209 11:65128715-65128737 CTGGGAAGAGAAGGGACGAGAGG + Intronic
1084313043 11:68327595-68327617 ATGGGGAGACTGGGCACAAGGGG - Intronic
1084402255 11:68951364-68951386 CAGAGGAGAGAGGCCCCCAGAGG + Intergenic
1084456138 11:69269163-69269185 CAGGGGAGAGAGAGGTCCAGTGG + Intergenic
1084532451 11:69735799-69735821 CTGGGGAGAGAGGGCACGTTGGG + Intergenic
1084688209 11:70709822-70709844 CTGGGGAGAGAGGAGAGAAGAGG + Intronic
1084939354 11:72604096-72604118 GAGGGCAGAGTGGGCACCAGTGG - Intronic
1084943919 11:72628871-72628893 CTGGAGAGAGTGGGGACCCGAGG - Intronic
1084945317 11:72635026-72635048 CTGGGCAGAAATGGCAGCAGTGG - Intronic
1085719836 11:78903219-78903241 CTGAGGAGGGTGGGCACCCGGGG - Intronic
1087691485 11:101325691-101325713 TTGGGGTGGGAGGGCAGCAGTGG + Intergenic
1087713819 11:101583778-101583800 CCGGGCAGAGAGGGCACAGGCGG + Exonic
1087780032 11:102291904-102291926 TTGGGGAGACAGTGCACAAGTGG - Intergenic
1088626530 11:111733987-111734009 CAGGGCTGAGAGGGCGCCAGGGG - Intronic
1088760201 11:112922331-112922353 CTGGGGAGAGAGGGCCCCAGAGG + Intergenic
1089221668 11:116877074-116877096 CTGGTGAGGGGAGGCACCAGGGG + Intronic
1089452473 11:118607832-118607854 TGGGGGAGAGAGGGCACCCCAGG + Intronic
1089584660 11:119502660-119502682 CTGGAATGAGAAGGCACCAGAGG + Intergenic
1089633164 11:119796096-119796118 CAGGGGAGAGAGGGAAGCATTGG + Intergenic
1089744252 11:120605929-120605951 CTGGGGAGAGGGTGTACCTGGGG + Intronic
1090277968 11:125432716-125432738 ATGGGGTGAGAGGGAACCGGAGG - Exonic
1090398439 11:126434062-126434084 CTGGGAAGAGATGGCACCCCGGG - Intronic
1091347693 11:134866357-134866379 CTGGCGAGAGGGGGAAGCAGGGG - Intergenic
1091613535 12:2031866-2031888 CAGGAGAGAGAGGGCAGCTGTGG + Intronic
1091616907 12:2056355-2056377 CAGAGCAGACAGGGCACCAGAGG - Intronic
1091636861 12:2203642-2203664 GTAGGGAAAGAGAGCACCAGGGG + Intronic
1091766022 12:3120431-3120453 GTGGGGAGAGCAGGCTCCAGGGG - Intronic
1091793507 12:3284603-3284625 CTGGGGAGTGAGGCCAGGAGTGG + Exonic
1092285105 12:7124175-7124197 CTGGGGAGAGAGGGGAAGTGAGG + Intronic
1096805967 12:54141298-54141320 CTGGGGAGAGAGGGGACAGGTGG - Intergenic
1097194204 12:57234956-57234978 CTGGGGACAGAGGGGAGCAAGGG + Exonic
1097240143 12:57569457-57569479 CTGAGGAGAGAGAGCCGCAGAGG - Intronic
1098394066 12:69999770-69999792 CTGCTAAGAGAGGGCACTAGAGG - Intergenic
1098689622 12:73470679-73470701 CTTGGGAGAAAGGGCAGGAGGGG + Intergenic
1100240857 12:92709503-92709525 TTGGTTAGAGAAGGCACCAGGGG + Intergenic
1100690532 12:97034370-97034392 CTGGGGAGATAGGGGAGGAGTGG + Intergenic
1100730586 12:97463228-97463250 ATGGCGAGAGGGGGCACCGGAGG + Intergenic
1100885600 12:99066483-99066505 CAGAGAAGAGAGGGAACCAGGGG + Intronic
1102259893 12:111437379-111437401 CTGTGGGGAAAGGGCACCTGAGG + Intronic
1102857295 12:116305468-116305490 CTGGGTAGTGAGGTCACGAGTGG - Intergenic
1103343428 12:120233673-120233695 ATAGGCAGAGAGGGCAACAGTGG - Intronic
1103953912 12:124566501-124566523 GCGGGGAGTGAGGGCACCCGTGG - Intronic
1104215127 12:126726939-126726961 CTGGGCGGAGAGGGCATCTGTGG + Intergenic
1104648994 12:130517545-130517567 TTTGGGAGAGTGGGCACCAATGG + Intronic
1104965576 12:132507523-132507545 ATGGGACGAGAGGGGACCAGGGG + Intronic
1104976858 12:132555996-132556018 CTGAGAAGAGAGGACCCCAGGGG - Intronic
1105429189 13:20321728-20321750 GTGGGTAGCGAGGGCTCCAGGGG + Intergenic
1105707846 13:22979584-22979606 CTGGGGAATGAGGGCTACAGGGG + Intergenic
1106293887 13:28392227-28392249 CTGAGGAGAGAGGATACCAGTGG + Intronic
1107080973 13:36374468-36374490 CTGGGGAGAGAGGGTACTTCTGG - Intergenic
1107738135 13:43419468-43419490 CTGGGGAGTGAGGGGTGCAGAGG + Intronic
1110241856 13:73276658-73276680 ATGGTGAGAGAGGGCACAAGGGG - Intergenic
1112133405 13:96549105-96549127 GTGAGGAGAAAGGGCAACAGGGG - Intronic
1113438872 13:110313217-110313239 CTGAAGGGAGTGGGCACCAGAGG - Intronic
1113634324 13:111909553-111909575 CTGGGCACAGAGGGGCCCAGGGG + Intergenic
1113714002 13:112489670-112489692 GTGGGGAGTGACGGCAGCAGAGG - Exonic
1113740775 13:112711019-112711041 CCGGGGTCAGAGGTCACCAGAGG + Intronic
1114462069 14:22892803-22892825 CTGGGGTGAGAGGTCAGCAGAGG + Intergenic
1115335951 14:32244468-32244490 CTGGGGAGAGAGGGGAGCAAGGG + Intergenic
1115441732 14:33443573-33443595 CCAGGCAGAGAGGGGACCAGTGG + Intronic
1117438562 14:55740396-55740418 CTGGGGACAGAGGGCAGCTGTGG + Intergenic
1118475360 14:66111340-66111362 CTGGGGAGAGGGGACAGTAGGGG + Intergenic
1119782310 14:77284677-77284699 CAGGGGAGAGAGGAGCCCAGAGG + Intronic
1119866990 14:77982168-77982190 ATGGGGGGAGGGGGCACCTGAGG - Intergenic
1123469514 15:20539727-20539749 CTGGGGACAGAGGGCCCAAGGGG - Intronic
1123648548 15:22460972-22460994 CTGGGGACAGAGGGCCCAAGGGG + Intronic
1123667017 15:22615873-22615895 CTGGGGACAGGGGGCCCAAGGGG - Intergenic
1123729792 15:23134713-23134735 CTGGGGACAGAGGGCCCAAGGGG - Intronic
1123747960 15:23332195-23332217 CTGGGGACAGAGGGCCCAAGGGG - Intergenic
1124280327 15:28356047-28356069 CTGGGGACAGAGGGCCCAAGGGG - Intergenic
1124302371 15:28555565-28555587 CTGGGGACAGAGGGCCCAAGGGG + Intergenic
1124320858 15:28710441-28710463 CTGGGGACAGGGGGCCCAAGGGG - Intronic
1124365834 15:29071000-29071022 TTAGGGATAGAGGGCATCAGTGG - Intronic
1124481635 15:30084914-30084936 CTGGGGACAGGGGGCCCAAGGGG + Intronic
1124488092 15:30137009-30137031 CTGGGGACAGGGGGCCCAAGGGG + Intronic
1124521955 15:30412283-30412305 CTGGGGACAGGGGGCCCAAGGGG - Intronic
1124536709 15:30553935-30553957 CTGGGGACAGGGGGCCCAAGGGG + Intronic
1124543183 15:30605986-30606008 CTGGGGACAGGGGGCCCAAGGGG + Intronic
1124563138 15:30793434-30793456 CTGGGGACAGGGGGCCCAAGGGG + Intergenic
1124598315 15:31109902-31109924 CTGGGGACAGAGGGCAGGTGTGG + Intronic
1124755435 15:32401310-32401332 CTGGGGACAGGGGGCCCAAGGGG - Intronic
1124761943 15:32453657-32453679 CTGGGGACAGGGGGCCCAAGGGG - Intronic
1124776686 15:32595411-32595433 CTGGGGACAGGGGGCCCAAGGGG + Intronic
1125024364 15:35015767-35015789 GTGGGGAGAGTGGGTACCAGAGG + Intergenic
1125368599 15:38945928-38945950 CTGGGGCTGGTGGGCACCAGAGG - Intergenic
1125400282 15:39295052-39295074 CTGGGTAGAGACTGCACCAATGG + Intergenic
1125533362 15:40428473-40428495 CTAGGGAGGGAGGGTACCAGGGG - Intronic
1125606091 15:40940818-40940840 CTGGGGAAAGTGGGGACCCGTGG + Intergenic
1125608662 15:40956615-40956637 CTGGGAAGAGAGGGAAGGAGAGG - Intergenic
1125758298 15:42080927-42080949 CGGGGCAGAGTGGGCACCAGAGG - Intronic
1126400501 15:48264059-48264081 CTGGGAACAGAGAGAACCAGGGG - Intronic
1127524472 15:59778720-59778742 ATGGGGAGTGATGGCACGAGTGG + Intergenic
1127672295 15:61206747-61206769 CTGGGCAGAGAGGGCTGCTGAGG - Intronic
1127922031 15:63501945-63501967 CTGGGGAGAGAAGTCACTAATGG + Intergenic
1128356980 15:66935025-66935047 CAGAGGAGAGTGGGCAACAGAGG - Intergenic
1128678896 15:69632131-69632153 CTGAGGAGAGAGGGGACCCCAGG - Intergenic
1128699250 15:69792127-69792149 TGGGGGAGAGAGGTCAACAGGGG + Intergenic
1128725804 15:69987820-69987842 TTGGGGAGAGAGGGCATTAGAGG - Intergenic
1128756376 15:70186409-70186431 CTGGGGAGAGACAGCCGCAGGGG - Intergenic
1128979254 15:72174810-72174832 ATGGGGAGACAGGGCAGGAGAGG + Intronic
1129029124 15:72605641-72605663 CTGGGGACAGGGGGCCCAAGGGG + Intergenic
1129037046 15:72656655-72656677 CTGGGGACAGGGGGCCCAAGGGG + Intronic
1129212841 15:74080570-74080592 CTGGGGACAGGGGGCCCAAGGGG - Intronic
1129342054 15:74892563-74892585 CTGGGGAGGGTGGACAGCAGGGG + Intronic
1129397561 15:75260516-75260538 CTGGGGACAGGGGGCCCAAGGGG + Intronic
1129401171 15:75284793-75284815 CTGGGGACAGGGGGCCCAAGGGG + Intronic
1129474763 15:75777494-75777516 CTGGGGACAGGGGGCCCAAGGGG + Intergenic
1129729978 15:77924890-77924912 CTGGGGACAGGGGGCCCAAGGGG - Intergenic
1129881024 15:79006022-79006044 CTGGGGAGAGGGGGCAGTGGCGG + Intronic
1129885051 15:79031733-79031755 CAGGGGAGAGAGAGCACGAGGGG + Intronic
1130047965 15:80460868-80460890 CTGGGGAGAGATGGGTCCAGAGG + Intronic
1130255899 15:82325967-82325989 CTGGGGTGAGAGGTGACCGGGGG - Intergenic
1130260037 15:82347464-82347486 CTGGGGACAGGGGGCCCAAGGGG - Intronic
1130275259 15:82472910-82472932 CTGGGGCACGAGAGCACCAGGGG - Intergenic
1130472567 15:84237729-84237751 CTGGGGACAGGGGGCCCAAGGGG + Intronic
1130480058 15:84352300-84352322 CTGGGGACAGGGGGCCCAAGGGG + Intergenic
1130484285 15:84389875-84389897 CTGGGGACAGGGGGCCCAAGGGG + Intergenic
1130491711 15:84435829-84435851 CTGGGGACAGGGGGCCCAAGGGG - Intergenic
1130503326 15:84514869-84514891 CTGGGGACAGGGGGCCCAAGGGG - Intergenic
1131395609 15:92083386-92083408 GTGGGAAGGGAGGGCACCTGAGG - Intronic
1131578828 15:93620090-93620112 CTGGGAAGGGAGGGGACCTGTGG - Intergenic
1131946099 15:97623585-97623607 CTGGGGAGAGCAGGCATCAGTGG + Intergenic
1132482110 16:171943-171965 CAGGGGAGAGAAGGCCCCTGTGG - Intergenic
1132483914 16:180606-180628 TTGGGGAGGGAGGGCCCCTGGGG - Intronic
1132603789 16:785297-785319 CCGGGCAGAGAGGGAACCACTGG + Exonic
1132686847 16:1165806-1165828 CTGGGGAGAAAGGAAACCATGGG - Intronic
1132977790 16:2719302-2719324 CCTGGGTGGGAGGGCACCAGTGG - Intronic
1132995401 16:2820008-2820030 CTGGGGAGAGAGGGTGGCAGAGG - Intronic
1133168505 16:3965474-3965496 CTCGGGACAGAGGCCGCCAGTGG - Exonic
1133247951 16:4461735-4461757 GTGGGGATCGGGGGCACCAGAGG - Exonic
1133878702 16:9760705-9760727 CTGGGTTTAGAGGACACCAGAGG + Exonic
1134032451 16:11003368-11003390 CTGGGTGGAGAGGGCACAGGTGG - Intronic
1135388693 16:22069742-22069764 CTGGGAAGTGAAGGCAGCAGAGG + Intronic
1136139366 16:28278792-28278814 CTGGGGACAAACGGCAGCAGTGG - Intergenic
1136458628 16:30396164-30396186 CTGGCGAGAGAATGCATCAGTGG - Intronic
1137055756 16:35746073-35746095 CTGGGGAGACTGGGGGCCAGAGG + Intergenic
1137247376 16:46716900-46716922 CTGGAGAGAGGGGGCACCCAGGG + Intronic
1137447851 16:48543082-48543104 CTGGGGAGGGCTGGCAGCAGTGG + Exonic
1137731092 16:50691088-50691110 GTGGGCAGAGAGGGTGCCAGAGG + Intergenic
1137792357 16:51185613-51185635 ATGGGGACAGAGGGAAACAGAGG + Intergenic
1138009416 16:53363501-53363523 CTGGAGACAGAGGGCCCAAGGGG - Intergenic
1138181734 16:54945157-54945179 CTGGAGAAAGAGGACACGAGGGG - Intergenic
1138350719 16:56344981-56345003 CTGGGGACAGAGGACAGCAGGGG + Exonic
1138448167 16:57077670-57077692 TCGGGGAGAGGGGGCATCAGAGG + Intronic
1138599349 16:58045843-58045865 CTTGGGAAGGAGGGGACCAGGGG - Exonic
1138929693 16:61637564-61637586 CTTGGGCAAGAGGGCACAAGTGG - Intergenic
1139837712 16:69853051-69853073 CTTTGGAGACAGGGAACCAGTGG + Intronic
1139958152 16:70703066-70703088 CTGCTGTGAGTGGGCACCAGGGG + Intronic
1140032055 16:71346729-71346751 GTGGGGAGAGAGGGGACCGTAGG + Intergenic
1140051373 16:71484406-71484428 TGGGGGAGCGAAGGCACCAGAGG + Intronic
1141003220 16:80327670-80327692 CTGGGTAGAGTGGGCTCAAGAGG - Intergenic
1141149266 16:81552859-81552881 CTGGGGACAGAGTGCACAAGAGG + Intronic
1141769761 16:86082704-86082726 CTGTGGAGAGAACGCACCCGTGG - Intergenic
1141894982 16:86953632-86953654 CGGGGGAGTGGGGGCAGCAGTGG - Intergenic
1142254047 16:89005581-89005603 CTGGAGGAAGAGGGCTCCAGGGG - Intergenic
1143101834 17:4508832-4508854 CTGAGGCCAGAGGTCACCAGTGG + Intronic
1143494081 17:7301172-7301194 CTGGGAGTAGATGGCACCAGGGG - Intergenic
1143759040 17:9088009-9088031 CTGGGGAGGAAGGACAGCAGTGG - Intronic
1143781280 17:9230880-9230902 GTGGGGAGAGAGGGCTCTAAGGG + Intronic
1143784948 17:9249071-9249093 CTAGGGACTGAGGGCTCCAGGGG - Intergenic
1143875150 17:9985741-9985763 CTGGGGTGAGAGGGGATCAACGG + Intronic
1144792724 17:17870227-17870249 AAGGGTAGAGAGGGCTCCAGGGG - Intronic
1145765803 17:27457304-27457326 CTGGGGCGTGAGGGGAACAGGGG - Intronic
1145844802 17:28029292-28029314 CTGGGCAGAGAGGGCTCTGGTGG - Intergenic
1145845303 17:28033456-28033478 CAGGGGAGAGAGAGATCCAGAGG + Intergenic
1146534194 17:33635678-33635700 CTGTATAGAGAAGGCACCAGAGG + Intronic
1146608584 17:34284972-34284994 CTGGGGAATAAGGGCACGAGAGG + Intergenic
1147979922 17:44268094-44268116 CTGGTCGCAGAGGGCACCAGCGG - Exonic
1147988097 17:44318073-44318095 CTGGGGAGAGAGGGCAGGTGAGG - Intronic
1148583797 17:48762373-48762395 CTGGTGAGGGAGGTCACCAGAGG + Exonic
1148772746 17:50076524-50076546 GTGGGGCGAGAGGGCACTGGGGG + Intronic
1148783503 17:50134390-50134412 CTGGGCAGACAGGGCAGCACAGG + Exonic
1149461441 17:56833394-56833416 CCGGGGAGAAAGGGGAGCAGCGG - Intronic
1149490066 17:57078125-57078147 CTGGGAAGCCAGGGCACCTGAGG + Intergenic
1149539156 17:57455668-57455690 CAGGAGAGCGAGGGCAGCAGAGG + Intronic
1149786662 17:59441256-59441278 CTGGGGAGAGACAGCACCCCAGG + Intergenic
1149812801 17:59693758-59693780 CTGGGGAGGGACGGCAACACTGG - Exonic
1150208069 17:63424198-63424220 CTGGGGAGAAGCGGCATCAGCGG - Exonic
1150423051 17:65056124-65056146 CTGGGGCGCGAGGGCACCCCGGG + Intronic
1150639236 17:66938540-66938562 CTAGGGAGAGATGACAACAGGGG - Intergenic
1151499204 17:74478142-74478164 CTGGGGAGAGGGGGCAGGGGAGG - Intronic
1151674249 17:75589598-75589620 CTGCGGGGAGCGGCCACCAGGGG - Intergenic
1151750134 17:76032483-76032505 GAGGAGAGAGTGGGCACCAGAGG - Intergenic
1151825014 17:76519272-76519294 CCAGGGAGAGAGGGAAGCAGGGG - Intergenic
1151828630 17:76537350-76537372 CTGGGCAGGGAGGGCGGCAGCGG - Intronic
1151847038 17:76663854-76663876 CAGCCCAGAGAGGGCACCAGAGG - Intergenic
1152088905 17:78236347-78236369 CAGGTGAGACAGGGCACCAGAGG + Intronic
1152227647 17:79099985-79100007 CTGGGCACAGAGGGCTGCAGTGG - Intronic
1152316360 17:79582959-79582981 CTGGCGGAAGTGGGCACCAGAGG - Intergenic
1152781026 17:82227517-82227539 CTGAGGAGGGAGAGCAGCAGAGG - Intergenic
1152802856 17:82339960-82339982 CTGGGGGGAGAGGACACTGGGGG - Intergenic
1153047375 18:869203-869225 ATGGGGAGAAACGGCCCCAGTGG + Intergenic
1154290520 18:13102338-13102360 CTGGAGCGAGAGGGGACCACAGG - Intronic
1155422669 18:25672117-25672139 CTGGGGAGCCAGGAGACCAGAGG - Intergenic
1155980114 18:32171129-32171151 CTGGGGAGAGTGGGGAGGAGTGG - Intronic
1156388387 18:36626999-36627021 CTGTAGAGAGAGGGCATCTGGGG - Intronic
1156491718 18:37500240-37500262 CTGGGGAGAGAGGGAGGCACAGG + Intronic
1156854834 18:41769468-41769490 CTGGGCAGACAGGTTACCAGAGG + Intergenic
1157900688 18:51513902-51513924 CTTGGGTGAGAGAGGACCAGGGG + Intergenic
1158813332 18:61063647-61063669 CTGGGAAAAGTGGTCACCAGGGG - Intergenic
1159312396 18:66726125-66726147 CTCAGGAGAGAGGGCCCCACAGG + Intergenic
1160046772 18:75393380-75393402 GTGGGGGGAGAGGGCACCAAGGG + Intergenic
1160817444 19:1042723-1042745 CTGGGGAGAAAGACCACAAGGGG - Intronic
1160918088 19:1507162-1507184 CTGGGGACAGAGGGTAGGAGTGG - Intronic
1161039162 19:2100818-2100840 CTGGGGACCGAGGCCACCACGGG + Intergenic
1161221697 19:3120822-3120844 CTGGGGAGGGAGGGGAGCTGCGG + Intronic
1161849652 19:6731792-6731814 CTGGGCAGAGAGGCCAGGAGGGG + Intronic
1161984485 19:7646219-7646241 CAGGGCAGGGAGGGCAGCAGGGG - Intronic
1162457771 19:10796288-10796310 ATGGGGAGAAAAGGCACCAGTGG - Intronic
1162744683 19:12791839-12791861 GTGTAGAGAGAGGCCACCAGGGG - Exonic
1163319973 19:16568887-16568909 CTGGGAGGAGAAGGCATCAGTGG - Intronic
1163579356 19:18129068-18129090 ATGGGCAGAGAAGGCACCTGAGG + Intronic
1163596927 19:18225854-18225876 CTGGTGGGAGGGGGCACCAAGGG + Intronic
1164244156 19:23415983-23416005 CTGGGGCGAGAGGGGGGCAGAGG + Intergenic
1164575014 19:29400839-29400861 CTTGGGAGAAAGGGCCACAGTGG + Intergenic
1164598895 19:29548098-29548120 CAGGGGAGAGAGGGCACAGCAGG + Intronic
1165152116 19:33766981-33767003 CTGGGGAAGGAGGGCAGGAGCGG - Intronic
1165745502 19:38228117-38228139 TTAGGGTGAGAGGGCAGCAGAGG + Intronic
1166077046 19:40419777-40419799 CTGGGGAGAGGGGCCATCAGTGG + Intergenic
1166206983 19:41276699-41276721 CTGTGGAGAGATGACAGCAGAGG - Intronic
1166257747 19:41618583-41618605 CTGGGTGAAGAGGGCAGCAGGGG + Intronic
1166317330 19:41996487-41996509 CTGAGGAGAGAGTGCATGAGGGG - Intronic
1166765536 19:45250724-45250746 CTGGGGAGAGAATGGGCCAGGGG + Intronic
1167384363 19:49155437-49155459 ATGGGGAGGGAGGGCCCCAGAGG - Intergenic
1167410220 19:49339834-49339856 CTGGGGAGACAAGGCACCGCAGG + Intronic
1167436279 19:49480546-49480568 CTGGGGACGGGGGGCACCTGTGG - Exonic
1168369689 19:55821859-55821881 CTGGGGAGAAAGAGAAACAGTGG - Intronic
925135099 2:1521499-1521521 CTGGGGAAAGAGGGCCCTGGGGG - Intronic
926204941 2:10829216-10829238 CCTGGGAGAGAGGACATCAGGGG - Intronic
926837966 2:17045228-17045250 CAGGAGAGAGAGAGCACAAGGGG + Intergenic
926981967 2:18582429-18582451 GTGGGGAGAGAGAGCAGCCGGGG + Intronic
927152169 2:20202554-20202576 CTGGAGACTTAGGGCACCAGGGG - Exonic
927702046 2:25275182-25275204 CTGGCCAGAGAGGGCACCCCTGG + Intronic
927899631 2:26809976-26809998 CAGATTAGAGAGGGCACCAGAGG + Intergenic
928080775 2:28310389-28310411 CTGGGGAGAGATGGCCTGAGGGG - Intronic
928425137 2:31171505-31171527 CTGAGGTGAGAGGGAAGCAGAGG + Intergenic
929667690 2:43846052-43846074 CTGTGGAGAGGGGCCACCTGGGG + Intronic
929777005 2:44936004-44936026 CTGGTGAGAAAGGGGACCTGAGG - Intergenic
932059708 2:68483378-68483400 CTGGGGAGATGGGACAGCAGAGG + Intronic
932462680 2:71893469-71893491 GTGGGGAGGAAGGGCACCTGTGG + Intergenic
932660859 2:73650733-73650755 CTGGGGAGAGAGGGAAATAAGGG - Intergenic
933430387 2:82169714-82169736 CAGGGGAGAGAGGACGTCAGTGG + Intergenic
933813016 2:86044772-86044794 CTGAGGAGAAAGGCCGCCAGTGG - Intronic
934552126 2:95269012-95269034 TTGGAGAGAGAGGGCAGCCGAGG + Intergenic
934780175 2:96964948-96964970 CTGGGGAGAGAGAACAGCAGGGG - Intronic
935626699 2:105177628-105177650 CAGGTGAGAGAGGGCAGCACAGG + Intergenic
936086742 2:109474486-109474508 CTGGGGACAGGCGGCAGCAGTGG + Intronic
936153499 2:110034022-110034044 CGGGGGACAGAGGTCACCAAAGG + Intergenic
936191182 2:110337393-110337415 CGGGGGACAGAGGTCACCAAAGG - Intergenic
936989391 2:118346414-118346436 CTGAGGAAAGAAGGGACCAGAGG + Intergenic
937233600 2:120417020-120417042 CTGGGGAGAGAGGGAGGGAGAGG - Intergenic
937295855 2:120809595-120809617 CGGGGGAGGGAGGGCGCCTGTGG + Intronic
937937715 2:127259476-127259498 CTGGGGAGAGAGAGCAGAAAGGG - Intronic
937969306 2:127536947-127536969 CTGTGGAGAGGCGGCACCACAGG + Intronic
938130744 2:128714153-128714175 CTGGGAATGGAGGACACCAGGGG - Intergenic
938291071 2:130150813-130150835 CTGGGGAGCGAGGGCAGCAGTGG - Intergenic
938372148 2:130776816-130776838 CTGGGGAGAGGAGACACCGGTGG + Intergenic
938465480 2:131522146-131522168 CTGGGGAGCAAGGGCAGCAGCGG + Intergenic
938617784 2:133017732-133017754 CTGGGGAGAGAAGGAAACAGTGG - Intronic
940250214 2:151666793-151666815 CTGAGGAGGGAGGGCCCCAGAGG - Intronic
940873893 2:158882057-158882079 CTGGTAAGAGGGGGCACCACTGG - Intergenic
941758984 2:169219965-169219987 GTGGGGAGAGCCGGAACCAGAGG - Intronic
944624586 2:201558490-201558512 CAGAGGAGACAGGGCAGCAGAGG - Intronic
945536680 2:211026296-211026318 TTGGGGAGGGTGGGCACAAGTGG - Intergenic
946134879 2:217637366-217637388 CTGGGGAGACAGCCCACCCGAGG + Intronic
947584105 2:231341965-231341987 CTGGGGAGAGAGGAGAGCAAGGG - Intronic
947591058 2:231386173-231386195 CTGGGGAGAGAGAGCACACTTGG - Intergenic
948183545 2:236001466-236001488 CTGGGCAGAGTGGGCTGCAGGGG + Intronic
948265172 2:236630553-236630575 ATGGGGAGGGAGTTCACCAGAGG + Intergenic
948345867 2:237297652-237297674 CTGGGGAGGGAAGGCTCCACAGG - Intergenic
948456261 2:238105989-238106011 CTGGGCAGGGAAGGCCCCAGGGG - Intronic
948776214 2:240290264-240290286 CTGGGCTGAGGGGGCCCCAGAGG - Intergenic
948835297 2:240623526-240623548 TTGGGGAGAGAGGGGCCCTGGGG + Intronic
948918275 2:241049244-241049266 CTCGGGAGAGCTGGCACCTGGGG + Intronic
1168821141 20:774564-774586 ATGGGGAGAAAGGACAACAGAGG + Intergenic
1169039623 20:2482362-2482384 CTGGGGAGTGAGGGCAGGACTGG + Exonic
1169143226 20:3237716-3237738 CTAGGGAGAAAGGGAAGCAGGGG + Intronic
1169266658 20:4171345-4171367 CTGGGGAGTGGGGGCACTAAGGG - Intronic
1170129978 20:13008958-13008980 CTGGGGACTGAGGGAACCTGGGG - Intronic
1170529492 20:17276661-17276683 GTGGTGAGAGAGGGCATCACAGG - Intronic
1170672061 20:18443667-18443689 CTACGCAGAAAGGGCACCAGAGG - Intronic
1171206203 20:23283247-23283269 CAGGAGGGAGAGGCCACCAGGGG - Intergenic
1171438359 20:25141255-25141277 CTGGGCACAGGGGGCACCTGTGG + Intergenic
1171519681 20:25766222-25766244 CTGGAAAGAGAGGGCAGGAGGGG + Intronic
1171544383 20:25989382-25989404 CAGGGGAGAGAGGGCCACGGGGG - Intergenic
1171557239 20:26090271-26090293 CTGGAAAGAGAGGGCAGGAGGGG - Intergenic
1171950772 20:31419715-31419737 GGTGAGAGAGAGGGCACCAGGGG - Intergenic
1172126574 20:32628108-32628130 CTGGGGAGGGGAGGCACCAAGGG + Intergenic
1172187439 20:33039931-33039953 CTGGGGACAGAGGACACCCCAGG + Intronic
1172599683 20:36175234-36175256 CTGGGGAGACAGGGCAGCTCTGG + Intronic
1172668237 20:36615375-36615397 CTGAGGAGAAAGGGGTCCAGGGG + Intronic
1172896303 20:38302787-38302809 TCGGGGAGACAGGGCACTAGGGG + Intronic
1172973328 20:38888966-38888988 CTGGGGAAGGAGGGTAGCAGAGG - Intronic
1173010904 20:39181193-39181215 ATGGGGAGAGATGGCAAGAGGGG - Intergenic
1173245514 20:41335045-41335067 CTGGGAGGAGAGGCCCCCAGTGG + Intergenic
1173664984 20:44757038-44757060 CTGGGGATAGAGGCCAGCAGGGG + Intronic
1173787532 20:45805310-45805332 CTGGGGATGGGGGGCACCAGAGG + Exonic
1173870339 20:46337842-46337864 CTGGGGAAGGAGAGCCCCAGAGG - Intergenic
1173934128 20:46846309-46846331 CTAAGGAGAGAGGGAGCCAGTGG + Intergenic
1174045546 20:47730104-47730126 CTGGGTAGAGAGGTCAGCTGAGG - Intronic
1174077056 20:47944939-47944961 CTGAGGAGAGAGGTAACTAGAGG + Intergenic
1174411791 20:50341229-50341251 CCGGGGAGCGAGGACACCAGGGG - Intergenic
1175599361 20:60260341-60260363 CTGAGGAGGGTGGGCACCTGGGG - Intergenic
1175811865 20:61862577-61862599 ATGGGGAGCGAGGGGTCCAGGGG - Intronic
1175824340 20:61928495-61928517 CTTGGAAGAGTGGGCACCAGAGG + Intronic
1175924733 20:62466128-62466150 CAGGGGCCAGAAGGCACCAGGGG + Intronic
1175952601 20:62591344-62591366 CTGGGCAGAGAGGCCACACGGGG + Intergenic
1176126108 20:63475604-63475626 CTGGGGAGGGAGCCCACCAGAGG - Intergenic
1176514119 21:7770590-7770612 CTGGGGAGAGATGGCAAGTGGGG + Intronic
1176653825 21:9572506-9572528 CTGGGAAGAGAGGGCAGGAGGGG + Intergenic
1176972971 21:15288176-15288198 CCAGGGAGAGAGGGTCCCAGTGG - Intergenic
1177072176 21:16524286-16524308 CAGCTGAGAGATGGCACCAGAGG - Intergenic
1178648232 21:34401114-34401136 CTGGGGAGAGATGGCAAGTGGGG + Intronic
1178980241 21:37257744-37257766 GTGGGGAGCGAGGGTACCAGAGG + Intronic
1179148748 21:38792759-38792781 CTTTGGAGACATGGCACCAGTGG + Intergenic
1179625223 21:42645459-42645481 CTGGGGACAGAGGCCTCCTGGGG + Intergenic
1181483050 22:23213180-23213202 CTGTGGAGAGATGGCTGCAGGGG - Intronic
1181610103 22:24006424-24006446 CTGGGAAGACAGGGCAGCTGGGG + Intergenic
1181668739 22:24415782-24415804 CTGGGGAGGGTGGGCACAGGGGG - Exonic
1183077544 22:35436467-35436489 CTGGGCAGAAGGGGCACCTGGGG + Intergenic
1183701011 22:39451072-39451094 CTGGGGACAGAGGGCCCTAAGGG - Intergenic
1183908677 22:41062261-41062283 ATGGGGAGAGAGGGGAACAAGGG - Intergenic
1183948111 22:41338290-41338312 CTGTGGGGAGAGGGCCACAGTGG - Intronic
1184068400 22:42133405-42133427 CTATGGAGAGAGGCCACCTGAGG - Intergenic
1184073312 22:42160486-42160508 CTGAGGACAGGGGGCCCCAGAGG + Exonic
1184205481 22:42999752-42999774 CTGGGGAGACAGGGCCACTGTGG + Intronic
1184248527 22:43247736-43247758 GTGGGGTGAGAGGGAGCCAGCGG + Intronic
1184355588 22:43977359-43977381 CTTGAGAGTGAGGGCAGCAGGGG + Intronic
1184364592 22:44042029-44042051 CTGGGAAGAGAAGAGACCAGGGG + Intronic
1184806341 22:46796982-46797004 CTGAGGACAGAAGGCAACAGTGG - Intronic
1184876744 22:47281133-47281155 CTGGGGGGCGAGGGCCCAAGGGG - Intergenic
949607470 3:5670102-5670124 GTGGGGAGAGAGGGGATAAGGGG + Intergenic
950624571 3:14235400-14235422 CTAGGAAGAGAGGTCAGCAGGGG + Intergenic
950655881 3:14435917-14435939 CAGGGAAGAGTGGGAACCAGGGG - Intronic
952238715 3:31507497-31507519 CCAGGGACAGAGGGCACAAGAGG + Intergenic
952401794 3:32970035-32970057 CTGGACAGAGAAGGCACTAGAGG + Intergenic
953051630 3:39349477-39349499 CTGGACAGAGAAGGCACTAGAGG + Intergenic
953647553 3:44769177-44769199 CTGTGAAGAGAGGACACAAGGGG + Intronic
953674279 3:44988153-44988175 CTGGGCAGAGAAGACACAAGAGG + Intronic
953877730 3:46675982-46676004 GTGGGGTGAGAGTGCACCTGCGG + Intronic
953878336 3:46679011-46679033 GTGAGGTGAGAGGGGACCAGTGG - Intronic
954132697 3:48568459-48568481 CTGGGGACAGGGGGCCCCTGTGG + Intronic
954469034 3:50675486-50675508 CTGTGCAGAGAGGGCGGCAGGGG + Intronic
955007263 3:54981548-54981570 CTGGGGAGAGAGAGAAAAAGAGG + Intronic
955756631 3:62231284-62231306 CTGGGGAGAGAGGAGAGAAGGGG + Exonic
957914947 3:86676545-86676567 CTGGGGAGAGAGGGAGGTAGAGG - Intergenic
960571514 3:119189292-119189314 CTGAGTAGTGAGGGCAACAGAGG + Intronic
960989539 3:123301670-123301692 CTGGGGGGAGAGGGTGGCAGTGG - Intronic
961339065 3:126205205-126205227 CTGGGGAGAGGGAGCACCTGGGG + Intergenic
961339102 3:126205340-126205362 CTGGGGAGGGGGTGCACCTGGGG + Intergenic
961450191 3:126999173-126999195 CTGAGAAGAGAGGGCAGCAGAGG + Intronic
961512716 3:127413001-127413023 CTGGGGAGGGAGGGCAGGTGTGG - Intergenic
961514721 3:127425436-127425458 CTGGTGATAGAGCTCACCAGGGG - Intergenic
961736240 3:129003771-129003793 CTGCGGGGACAGGGCAGCAGGGG - Intronic
961766027 3:129211808-129211830 GTGGGAAGAGAGGGCTGCAGAGG - Intergenic
962359490 3:134725879-134725901 CAGAGGAGCGAGGGCAGCAGAGG + Intronic
962900770 3:139759449-139759471 CTGGGGAGGAAGGGCCCCTGGGG - Intergenic
963039140 3:141055924-141055946 CTGAGGAGAGAAGGCAGCACTGG + Intronic
963141883 3:141952916-141952938 CTGGGGTAAGGTGGCACCAGTGG + Exonic
964443810 3:156739728-156739750 CTGAAGAGAGAGGGCAGCTGAGG - Intergenic
965731637 3:171778472-171778494 CTGGAGAGAGATGGCATAAGTGG + Intronic
967345623 3:188452375-188452397 CTGGGGAGAAAGGAAACAAGAGG - Intronic
967768234 3:193305812-193305834 CAGGGGAGAGAGGGCACTCCAGG - Intronic
968035590 3:195544840-195544862 GGAGGGAGAGACGGCACCAGTGG - Intergenic
968445764 4:651326-651348 ATGGGGAGTGGGGGCCCCAGGGG + Intronic
968657682 4:1785683-1785705 CTGGGGAGTGAGGGCCTCAGGGG - Intergenic
968675236 4:1874396-1874418 CAGGGGAGAAAGGTCACAAGTGG - Intronic
968910829 4:3476231-3476253 GTGGGGTGAGAGGGCATCACGGG - Intronic
968910838 4:3476257-3476279 GTGGGGTGAGAGGGCATCACGGG - Intronic
969214191 4:5709446-5709468 ATGGGGAGAGAGGCTGCCAGGGG - Intronic
969697790 4:8744929-8744951 CAGGGGAGAGATGGCACAGGAGG - Intergenic
969712156 4:8850516-8850538 CTGGCCAGGGAGGGCAGCAGAGG - Intronic
970353305 4:15227888-15227910 CTGGGGAGCGAGGAAGCCAGTGG + Intergenic
970945684 4:21688802-21688824 CTGGGGAGAGAGAGGATTAGTGG - Intronic
975702079 4:77075978-77076000 CTGGGGAGGGAGGGGAAGAGAGG + Exonic
977458646 4:97297009-97297031 ATGGGAAGAGAGTGCACCAGAGG - Intronic
979260230 4:118637614-118637636 CTGGTGAGGGAGGTGACCAGTGG - Intergenic
980974298 4:139596333-139596355 GTGGGCAGAGAGGCCACTAGAGG + Intronic
982320082 4:154068181-154068203 TTGGGGAGACAGGGCTGCAGAGG + Intergenic
982450369 4:155545153-155545175 CTGGGGGCAGAGGGCAGCAGTGG - Intergenic
985910728 5:2878620-2878642 ATGGGGAGTGAGGCCACCAGAGG + Intergenic
990334423 5:54757965-54757987 CTGGTTAGAGAGGAAACCAGTGG + Intergenic
992084138 5:73262885-73262907 CTGGGGAGACAGTGCAACAGGGG - Intergenic
992527863 5:77629820-77629842 GTGGGGAAAGAGGGGACCGGAGG + Exonic
993439145 5:87934087-87934109 TTGGGGAGAGAAATCACCAGTGG - Intergenic
995683189 5:114743675-114743697 CGGGGGAGACAGGGCAGCTGTGG - Intergenic
995738635 5:115330555-115330577 GTGGGGAAAGAGGGGAACAGGGG + Intergenic
996244099 5:121238172-121238194 GTGGGGAGAGAGGGCATCCCTGG + Intergenic
996993612 5:129667607-129667629 ATGGGGAGAGAGGGAGCAAGGGG - Intronic
997673345 5:135694316-135694338 CTGTGGAGGGAGGGCTGCAGAGG + Intergenic
997735864 5:136212359-136212381 GTGGGGAGAGCAGCCACCAGAGG - Intergenic
998200310 5:140113691-140113713 CTGGGGAGTTAGGGGACTAGGGG - Intronic
999230334 5:150057950-150057972 CAGAGAAGAGAGGGCACAAGGGG - Intronic
1000337733 5:160254059-160254081 CTGTGGAGATAGGGCAGCATGGG - Intronic
1001566314 5:172701637-172701659 CTGGGGAGGGTGGGCAGAAGGGG + Intergenic
1001773856 5:174314394-174314416 CAGGGGAGCAAGGGCAGCAGGGG + Intergenic
1001960670 5:175878835-175878857 CTGGGGAGAGAGGGGCCGGGTGG - Intronic
1001993252 5:176134339-176134361 CAGAGGAGAGCGGGCAGCAGAGG + Intergenic
1002169120 5:177365720-177365742 CTGGGGGAGGAGGGAACCAGGGG + Intronic
1002208849 5:177583614-177583636 GTAGGGAGATAGTGCACCAGTGG + Intergenic
1002640520 5:180628571-180628593 CAGGGCAGAGAGGGGCCCAGCGG + Intronic
1004296432 6:14416071-14416093 GTGGGGAGAGAGGGCCCCAAGGG - Intergenic
1004356196 6:14931837-14931859 TTGGGGAGAGAGGGCACTAATGG + Intergenic
1006339474 6:33438752-33438774 CTGGGGGGTGGGGGCACAAGAGG - Intronic
1006522392 6:34578664-34578686 CTGGGGAGGGATGGCCACAGAGG + Intergenic
1007400152 6:41598729-41598751 CAGGGGGCAGAGGGCATCAGAGG + Intronic
1007729799 6:43938934-43938956 CTGGGAAGAGGTGGCCCCAGGGG - Intergenic
1007798927 6:44375415-44375437 CTTGGGAGATAGGACATCAGGGG + Intronic
1011000458 6:82582733-82582755 CTCAGGAGAGAGGTCTCCAGAGG + Intergenic
1011821829 6:91262102-91262124 ATGGTGAGAGAGGGGACAAGAGG + Intergenic
1012663620 6:101937349-101937371 CTTAGGAGAGAGGGCCCCACAGG + Intronic
1013760371 6:113510969-113510991 GTGAGGAAAGAGGGCAGCAGTGG + Intergenic
1014167787 6:118245511-118245533 CTGGGAGGAGAGAGCAGCAGAGG - Intronic
1016844106 6:148554136-148554158 CTGGGGACAGAGAGGGCCAGAGG + Intergenic
1017023691 6:150162937-150162959 ATGATGAGAGATGGCACCAGCGG + Intronic
1017073866 6:150600202-150600224 GTGGGGACAGAGGGCGCCGGGGG + Intronic
1018203484 6:161415828-161415850 GTGGGGAGAGAGGGACGCAGTGG - Intronic
1019408763 7:897660-897682 CTGGGGAAGGGGGGCACCTGGGG + Intergenic
1019421582 7:953590-953612 CTGTGGAGAGAGGGCCCCGCCGG - Intronic
1019432687 7:1006826-1006848 CTGGGGAGAGGAGGGTCCAGAGG - Intronic
1019486153 7:1290286-1290308 TGGGGGAGAGAGGGCAGGAGAGG + Intergenic
1019600600 7:1881797-1881819 CTGGAGTGAGGGGGCACCATGGG - Intronic
1019712713 7:2524824-2524846 CTGGGCCGAGAGGTCACCAAGGG + Intronic
1019778436 7:2925918-2925940 GTGGGGAGAGAGGCCAACATTGG - Intronic
1021434865 7:20602656-20602678 CTGAGGAGAAGGTGCACCAGTGG - Intergenic
1021879573 7:25081292-25081314 GTGCGGAGAGATGGCACCAGGGG + Intergenic
1022017876 7:26367660-26367682 GTGAGGGGAGGGGGCACCAGGGG - Intronic
1022375399 7:29806949-29806971 GTGGGGAGCGAGGTCACCACGGG + Intronic
1022477975 7:30724009-30724031 CAGGGGAGGGAGGGGAGCAGCGG - Intronic
1023401948 7:39797215-39797237 CTGGTGAGGGAGGTGACCAGTGG - Intergenic
1023622433 7:42087030-42087052 CTGGGGTGTGAGGGCAGAAGAGG + Intronic
1024075928 7:45817845-45817867 CTGGTGAGGGAGGTGACCAGTGG - Intergenic
1024281017 7:47720088-47720110 CTGGGGAAAGGGGACCCCAGTGG - Intronic
1024647672 7:51383447-51383469 CTGGTGAGGGAGGTGACCAGTGG + Intergenic
1024961374 7:54980672-54980694 CTGGGGGGAGAGGCCTCCTGGGG - Intergenic
1025051507 7:55737939-55737961 CTGGTGAGGGAGGTGACCAGTGG + Intergenic
1025128470 7:56363606-56363628 CTGGTGAGGGAGGTGACCAGTGG + Intergenic
1025176855 7:56806484-56806506 CTGGTGAGGGAGGTGACCAGTGG + Intergenic
1025280169 7:57621172-57621194 CTGGGAAGAGAGGGCAGGAGGGG + Intergenic
1025295773 7:57774449-57774471 CAGGGGAGAGAGGGCCGCGGTGG - Intergenic
1025304564 7:57844329-57844351 CTGGGAAGAGAGGGCAGGAGGGG - Intergenic
1026044865 7:66900074-66900096 CTGTGTGGAGAAGGCACCAGGGG + Intergenic
1026442518 7:70456769-70456791 CTGGGAGGAGAGGTCATCAGAGG - Intronic
1027402455 7:77822677-77822699 TTGGGGAGACAGGGCTGCAGTGG + Intronic
1029647980 7:101869974-101869996 CTGGGGAGGGAAGGCACAAGAGG - Intronic
1030077145 7:105746485-105746507 CTAGGCAGAGAGGGCACCAGGGG - Intronic
1031506977 7:122596995-122597017 CTGGGGAGAGAGGACACAAGAGG + Intronic
1031610808 7:123824809-123824831 CTGAGGAGAGATGACAGCAGTGG - Intergenic
1031842287 7:126758512-126758534 CTGGGGAGAAAGAGGACAAGAGG + Intronic
1032052460 7:128657607-128657629 CTGGTGAGGGAGGTGACCAGTGG - Intergenic
1033247432 7:139729567-139729589 CAGGTGAGAGAGGGCACACGAGG - Intronic
1033347219 7:140534854-140534876 CAGGGAAGAGAAGGCCCCAGTGG + Intronic
1033456938 7:141511494-141511516 CTGGCTAGGGAGGGCACCTGAGG - Intergenic
1035025112 7:155820072-155820094 CTGGGAAGAGGGAGCATCAGGGG + Intergenic
1035266282 7:157691875-157691897 CTGGGGAGAGAGAGCATGGGCGG - Intronic
1035708961 8:1698184-1698206 CTGGGATGAGAGGGAACCTGTGG - Intronic
1035743969 8:1948187-1948209 CCCGGGAGAGTGGGCGCCAGGGG - Intronic
1036222672 8:6933895-6933917 AGGGGGATAGAGGTCACCAGGGG + Intergenic
1036571283 8:9981874-9981896 ATGGCGAGAGAGGGCACAGGAGG + Intergenic
1037299212 8:17433877-17433899 CTGGGGGGAGGTGGAACCAGGGG - Intergenic
1037305478 8:17498880-17498902 CTGGGGAGACAGGGGAGCTGTGG + Intronic
1037562080 8:20084209-20084231 CTGGGGACAGAGAGCAGCTGGGG - Intergenic
1037648437 8:20815154-20815176 GTGGGGAGAGAGGATTCCAGTGG - Intergenic
1037703488 8:21295979-21296001 CTGGGGGGAGAGGGAAAGAGGGG - Intergenic
1037771693 8:21804839-21804861 CAGGGGAGAAAGGGCAGTAGGGG - Intronic
1037786493 8:21906321-21906343 CTGGAAAGGGAGGGTACCAGGGG + Intergenic
1037822656 8:22142357-22142379 GTGGGGGGAGAGGGAACCTGAGG + Intergenic
1037946434 8:22992536-22992558 CTAGGCAGAGAGGGTACAAGAGG - Intronic
1038871281 8:31496598-31496620 CTGGGTAGAGAGGGAAGCAAAGG - Intergenic
1039466509 8:37788819-37788841 CTAGGGAGAGGGGGCGACAGAGG - Intronic
1039507069 8:38059881-38059903 CTGGGGAGAGAGGGGACAGAGGG - Intronic
1039722476 8:40179569-40179591 CTGGGGAGATAAGGTACAAGAGG + Intergenic
1040025712 8:42780011-42780033 CAGGGGAGAGAGAGCAAGAGTGG + Intronic
1041245607 8:55885781-55885803 CTGGAGAGAAAAGGCCCCAGAGG + Intronic
1042516203 8:69662052-69662074 CGGGGAAGAGAGGGCATCGGGGG + Intergenic
1044479833 8:92672383-92672405 CTGGGGGGAGGGGGCAGGAGGGG - Intergenic
1046599105 8:116297049-116297071 CAGGGGAGAGGGAGCATCAGAGG - Intergenic
1048339834 8:133529901-133529923 CTGGGGAGTGCTGGCAGCAGAGG - Intronic
1049095321 8:140545097-140545119 ATGCGGGGAGAGGGCAGCAGAGG - Intronic
1049150987 8:141035444-141035466 GTGGGGAGCGAGGGCAGGAGGGG - Intergenic
1049389689 8:142361330-142361352 CGGGTCAGTGAGGGCACCAGAGG + Intronic
1049483950 8:142841733-142841755 CTGGGGAGAGAGGGCACCAGAGG - Intronic
1049560445 8:143307533-143307555 CGTGGCAGAGAGGGCAGCAGAGG + Intronic
1049600554 8:143505499-143505521 CTGGGAAGAATGGCCACCAGTGG - Intronic
1050070904 9:1812868-1812890 TTGGGGAAAGAGGTCACCAAAGG + Intergenic
1051357629 9:16254372-16254394 CTGGGGAGAAAGGGAAGCTGGGG - Intronic
1051539002 9:18193503-18193525 GTGGGGAGGGAGAGAACCAGAGG - Intergenic
1053439472 9:38104390-38104412 CTGGGCACAGCGGGCACTAGAGG + Intergenic
1054730324 9:68695855-68695877 CTGGGGAGAGGGGGCATAATAGG - Intergenic
1055126810 9:72728335-72728357 CAGTCAAGAGAGGGCACCAGAGG - Intronic
1056957905 9:91097146-91097168 GTGGGGGAAAAGGGCACCAGTGG - Intergenic
1057075061 9:92134293-92134315 CTGGGCAGAGAAGGCATCAAGGG + Intergenic
1057315153 9:93963618-93963640 GTGAGCTGAGAGGGCACCAGTGG - Intergenic
1057379195 9:94553700-94553722 CAGGGAATAGAGGGCACCACGGG - Intergenic
1057595081 9:96409093-96409115 ATGGTGAGAGAGGGAACAAGAGG - Intronic
1057742227 9:97721844-97721866 CTGGGGACAGAAGGCATCATGGG - Intergenic
1057797559 9:98169551-98169573 CTGAGGACAGAGGGGACCCGGGG - Intronic
1058903607 9:109462610-109462632 CTGGGGTGGGTGGGCACCATAGG + Intronic
1059400947 9:114070572-114070594 TTGGGCAGAGAGGGCCCCTGAGG + Intronic
1059646783 9:116275926-116275948 CTGGGGGATGAGGGCACCAGGGG - Intronic
1060517695 9:124276112-124276134 CTGGGGAGAGTGGGGAGAAGTGG + Intronic
1060722792 9:125989725-125989747 CTGGAGAGAGACTGCACCACTGG - Intergenic
1061037269 9:128120766-128120788 TTGGGAAGAGTGGGAACCAGGGG + Exonic
1061045810 9:128164283-128164305 CTGGGGAGACAGGCCAAGAGTGG - Intergenic
1061061120 9:128250894-128250916 TTGGGGCGCGAGGGCACCTGAGG - Exonic
1061065238 9:128273804-128273826 CTGGGGACAGGGGGCCCAAGGGG - Intronic
1061178073 9:129009239-129009261 CTGGCCACAGAGGGCACCACAGG + Exonic
1061212333 9:129201114-129201136 CTGGGGACAGAAAGCCCCAGGGG + Intergenic
1061507662 9:131040687-131040709 CTGGGGAGAGGGGGCAGGGGTGG - Intronic
1061537726 9:131259958-131259980 CTGGGAAGAGAGGGGAGAAGAGG + Exonic
1061870923 9:133520070-133520092 GTGGGGATAGAGGGCTGCAGCGG + Intronic
1061888081 9:133603034-133603056 CCAGGGAGAAAGGGCACCTGGGG + Intergenic
1061937266 9:133864693-133864715 TAGGGGACAGAGGGCCCCAGCGG - Intronic
1061949199 9:133926773-133926795 CTGGGAAGACAGGGAGCCAGGGG - Intronic
1062249776 9:135588287-135588309 CAGGGGTGAGAGGGCAGCTGTGG - Intergenic
1062434160 9:136539124-136539146 CAGGGCAGACAGTGCACCAGGGG - Intronic
1062554994 9:137109852-137109874 CTGGGGACAGTGGGCACCCTGGG + Intergenic
1062646446 9:137550822-137550844 CTGGGGAGAGGGTGCAGCTGGGG + Intergenic
1062662963 9:137649039-137649061 CTGGGGAAACTGGGCATCAGTGG + Intronic
1203631546 Un_KI270750v1:75958-75980 CTGGGAAGAGAGGGCAGGAGGGG + Intergenic
1186173613 X:6902746-6902768 CTGGTGAGAGAGAGTTCCAGGGG + Intergenic
1190037048 X:47035131-47035153 CTGGGGAGAGAGGGCATGAGTGG - Intronic
1190115955 X:47626520-47626542 CTGCAGAGACAGGGCAACAGGGG + Intronic
1190732113 X:53233298-53233320 CTGGGGAGAGAGGCTCCCAAAGG - Exonic
1191877386 X:65810199-65810221 CTTGAGAGAGAGAGCCCCAGTGG + Intergenic
1196483289 X:116176300-116176322 CAGGGTAGAGGGGGCAGCAGGGG - Intergenic
1197002319 X:121453166-121453188 CAGGGGAGAGAGGAGACCATGGG - Intergenic
1198203901 X:134448301-134448323 GTGGGGAGCGAGGGGACCAGGGG - Intergenic
1198310637 X:135424106-135424128 CAAGGGAGAGAGGGGCCCAGGGG + Intergenic
1199636579 X:149818959-149818981 CAGGAGAGAAAGGGCACAAGGGG + Intergenic
1199832932 X:151562794-151562816 CTGGGGTGAGGGGGCAGCGGGGG + Intergenic
1199945518 X:152663167-152663189 CTGGGGAGGGAGGGGAGCAAGGG - Intergenic
1200210537 X:154345008-154345030 CAGGGGAGAGAGGGTCACAGAGG - Intergenic
1200220315 X:154387084-154387106 CAGGGGAGAGAGGGTCACAGAGG + Intergenic
1200235158 X:154464533-154464555 CTGGGGATAGAGGGGACCTCTGG + Intronic
1202095719 Y:21246637-21246659 CAGTGGAGAGAGGGGACCAATGG - Intergenic
1202366602 Y:24170057-24170079 CTGGGGACAGGGGGCCCAAGGGG + Intergenic
1202381716 Y:24279984-24280006 CTGGTGAGGGAGGTGACCAGTGG - Intergenic
1202489069 Y:25390142-25390164 CTGGTGAGGGAGGTGACCAGTGG + Intergenic
1202504180 Y:25500066-25500088 CTGGGGACAGGGGGCCCAAGGGG - Intergenic