ID: 1049483953

View in Genome Browser
Species Human (GRCh38)
Location 8:142841742-142841764
Sequence GTTAGGGCCCTGGGGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 366}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049483953_1049483968 27 Left 1049483953 8:142841742-142841764 CCCTCTCTCCCCAGGGCCCTAAC 0: 1
1: 0
2: 5
3: 30
4: 366
Right 1049483968 8:142841792-142841814 AGTGACCAATGGAGCAAGCAGGG No data
1049483953_1049483962 1 Left 1049483953 8:142841742-142841764 CCCTCTCTCCCCAGGGCCCTAAC 0: 1
1: 0
2: 5
3: 30
4: 366
Right 1049483962 8:142841766-142841788 TGCAGAAGATGTATGGCCAGAGG No data
1049483953_1049483967 26 Left 1049483953 8:142841742-142841764 CCCTCTCTCCCCAGGGCCCTAAC 0: 1
1: 0
2: 5
3: 30
4: 366
Right 1049483967 8:142841791-142841813 CAGTGACCAATGGAGCAAGCAGG No data
1049483953_1049483963 16 Left 1049483953 8:142841742-142841764 CCCTCTCTCCCCAGGGCCCTAAC 0: 1
1: 0
2: 5
3: 30
4: 366
Right 1049483963 8:142841781-142841803 GCCAGAGGCCCAGTGACCAATGG No data
1049483953_1049483969 30 Left 1049483953 8:142841742-142841764 CCCTCTCTCCCCAGGGCCCTAAC 0: 1
1: 0
2: 5
3: 30
4: 366
Right 1049483969 8:142841795-142841817 GACCAATGGAGCAAGCAGGGAGG No data
1049483953_1049483960 -6 Left 1049483953 8:142841742-142841764 CCCTCTCTCCCCAGGGCCCTAAC 0: 1
1: 0
2: 5
3: 30
4: 366
Right 1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049483953 Original CRISPR GTTAGGGCCCTGGGGAGAGA GGG (reversed) Intronic
900245946 1:1636118-1636140 GTCAGGAACCTGGGGGGAGAGGG + Exonic
900257171 1:1703261-1703283 GTCAGGAACCTGGGGGGAGAGGG + Exonic
900362395 1:2295533-2295555 ATTTGGGGCCTGGGGAGTGACGG - Intronic
900589202 1:3452260-3452282 CTTAGGGCCCCAGGGAGGGAGGG + Intergenic
900678603 1:3903796-3903818 GTTGGGGAGCTGGGGAAAGAAGG - Intergenic
900879316 1:5369159-5369181 TTTGGGGCCCTGTGCAGAGAAGG - Intergenic
901059042 1:6463219-6463241 GTGAGAGGCCTGGGGAGGGAAGG - Intronic
901609912 1:10489789-10489811 TTTCAGGCCCTGGAGAGAGACGG - Intronic
902379992 1:16048329-16048351 GAAAGGGCCCTGCAGAGAGAAGG - Exonic
902436398 1:16400697-16400719 GTGAGGGCCCTGGGCAGGGTGGG - Intronic
902939143 1:19787234-19787256 GCAAGGGCCCAGGGGAGCGACGG - Intronic
903109253 1:21115297-21115319 GCAAGGTCCATGGGGAGAGAGGG + Intronic
903861620 1:26368004-26368026 GAGAGGGCCCTGGGGACAGGAGG - Intronic
904359346 1:29961832-29961854 GCAAAGGCCCTGGGGTGAGAAGG - Intergenic
904436805 1:30504390-30504412 ACTAGGGCCTTGGGGACAGAAGG + Intergenic
905632708 1:39527509-39527531 GGGAGGGGCCTGGGGAGAGCTGG + Intergenic
905733172 1:40310263-40310285 GGCAGGGCCCAAGGGAGAGACGG - Exonic
906152273 1:43594458-43594480 GTCAGGGCCTTGGGGACACAGGG + Intronic
907263969 1:53243813-53243835 GTTAGGGCTCAAAGGAGAGAGGG - Intergenic
907371901 1:54009216-54009238 GTTGGGGCCATGGGGAGCTACGG - Intronic
910686031 1:89917548-89917570 GCAAAGGCCCTGTGGAGAGAGGG - Intronic
911001753 1:93173048-93173070 GTGGGGGACTTGGGGAGAGAGGG + Intronic
911150117 1:94590349-94590371 AGGAGGGCCCTGGGGAGAGAGGG - Intergenic
912588328 1:110787729-110787751 GTTAGGCCACTGGGCAGGGATGG - Intergenic
912752628 1:112298487-112298509 GTTGGGGGTCTGTGGAGAGAAGG - Intergenic
913538354 1:119795659-119795681 GTGAGAACCCTGGGGAGAGGAGG + Intronic
914095454 1:144540602-144540624 GGTAGGGTCCTGGGGCGGGAGGG + Intergenic
914303071 1:146393291-146393313 GGTAGGGTCCTGGGGCGGGAGGG - Intergenic
915033748 1:152905706-152905728 GACAGTGCCCTGGGGAGAGGAGG + Intergenic
915456625 1:156044756-156044778 GTAGGGGACCTGGGGAGTGAGGG - Intronic
915633228 1:157168073-157168095 ATTAGGGCCCTTAGGAAAGACGG + Intergenic
916039600 1:160950861-160950883 GTTAGGGCCCTGGGTGGTGGTGG - Intronic
918080883 1:181206914-181206936 GTTAGGGCGGTGTGAAGAGAAGG + Intergenic
919914975 1:202133663-202133685 GTGGGGGCCCTGGGGAGGGGCGG + Exonic
921447572 1:215264539-215264561 GAGAGGGACCTGGGAAGAGAAGG - Intergenic
921599180 1:217089133-217089155 GTTAGGGCGCTGGGAGGGGAGGG - Intronic
921617758 1:217291396-217291418 GGTAGGGCAGTGGGGAGGGAAGG - Intergenic
922472300 1:225883843-225883865 GCTAGAGCTTTGGGGAGAGAAGG - Intergenic
922608081 1:226903488-226903510 TTTAGGGACCTGGGGAAAGGAGG - Intronic
922746491 1:228047224-228047246 GACAGGGCCCTAGGGAGGGACGG + Intronic
923684371 1:236143419-236143441 GTTAGGTGCCTGGGGAGGCAGGG - Intronic
923761008 1:236844067-236844089 CTTAGGGCACTGGGGAGAAGAGG + Intronic
924165414 1:241276706-241276728 TTTAAGTCCCTTGGGAGAGAAGG - Intronic
924468522 1:244318971-244318993 GTTAAGAACCTTGGGAGAGAGGG - Intergenic
924643582 1:245856821-245856843 GTTGGGGGCCTGGAGAAAGAAGG + Intronic
1063001136 10:1924047-1924069 GAGAGGGCCCTGGGGGGACAAGG + Intergenic
1064453426 10:15464762-15464784 GTTTGGGGGGTGGGGAGAGATGG + Intergenic
1064964028 10:20997352-20997374 GGCAGTGCCATGGGGAGAGATGG - Intronic
1065485955 10:26236839-26236861 ATGAGGGCCCTGAGGTGAGAAGG - Intronic
1066225871 10:33382751-33382773 GTCAGGCTCCTGGGCAGAGATGG + Intergenic
1066444577 10:35470122-35470144 GATAGGGCGATGGGGAGACAAGG + Intronic
1066650420 10:37650056-37650078 AGTAGGGCCTTGGGGATAGATGG + Intergenic
1067759919 10:49037157-49037179 GTCAGCCCCCTGGGGAGAAAGGG - Intronic
1069751389 10:70747468-70747490 ATTAGGGGCCGGGGGAGGGAAGG + Intronic
1069856417 10:71443484-71443506 CTAAGGGGCCTGAGGAGAGAGGG - Intronic
1070605566 10:77895837-77895859 ATTTGAGCCCTGGGTAGAGATGG - Intronic
1070681941 10:78454808-78454830 GGTAGGGACCTGGGGGGAGAAGG + Intergenic
1071819425 10:89264858-89264880 GATAGGCCCCTGGGCAGAAAGGG - Intronic
1072321637 10:94255967-94255989 GAGAGGGGCGTGGGGAGAGAGGG - Intronic
1072766593 10:98099410-98099432 GCTAGGGCCCTGGGAACACAGGG - Intergenic
1073117130 10:101097515-101097537 GATAGGGCCCTGGGGAGCAGGGG + Intronic
1074809588 10:117090389-117090411 GTCAGGGGCCAGGGGACAGAAGG + Intronic
1076365032 10:129916183-129916205 GTGAGAGCCTGGGGGAGAGACGG + Intronic
1077309290 11:1881368-1881390 GTGTGGGCCCTGGGCAGAGGAGG + Intronic
1077329701 11:1978805-1978827 GTCAGGGCCCTGAGGAGGAAGGG + Intronic
1077453483 11:2664508-2664530 GTTTGGGCCCTGAGGAAACAGGG - Intronic
1077798799 11:5517989-5518011 GTGAGGTCCCTGGGGAGAAAAGG - Intronic
1078259156 11:9688442-9688464 GCAAGGGCCCAGGGGAGAAAGGG + Intronic
1078654075 11:13222038-13222060 GCAGGGGCACTGGGGAGAGAAGG - Intergenic
1078657375 11:13254227-13254249 GTGAAGGCTCTGGGGTGAGAAGG - Intergenic
1079122465 11:17695756-17695778 GTGGGGGTGCTGGGGAGAGACGG + Intergenic
1079129465 11:17738872-17738894 TTGAGGCCACTGGGGAGAGAAGG - Intronic
1079327705 11:19508454-19508476 GCAAAGGCCCTGAGGAGAGAAGG - Intronic
1079336495 11:19574958-19574980 GTGAAGGCCCTGAGGAGGGATGG + Intronic
1082835128 11:57645923-57645945 GGCAGGGCCGTGGGGAGGGAGGG + Exonic
1082848349 11:57744094-57744116 GTTAGGGGCCTTGGGAGGGTGGG - Exonic
1083729929 11:64647444-64647466 GTTAGAGCCCTGCAGAGGGAGGG - Intronic
1083794208 11:65005285-65005307 GTAAGGGCCATGGGGAGTGTGGG + Intergenic
1083881151 11:65548886-65548908 GTTAGGGCTCAGGTGGGAGATGG - Intronic
1084094975 11:66905329-66905351 GTGAGTGCACTGGGGTGAGAGGG + Intronic
1084430815 11:69110142-69110164 GTTGGGATCCTTGGGAGAGAGGG + Intergenic
1085305876 11:75485893-75485915 GCTAGGGCCCTGGGGAAGGGGGG + Intronic
1086834153 11:91600664-91600686 GGTACAGGCCTGGGGAGAGAAGG - Intergenic
1088511343 11:110578987-110579009 AATAGGGGCCTGAGGAGAGAGGG - Exonic
1088532799 11:110828809-110828831 GGTAGGGCCCTAGGGAAGGATGG + Intergenic
1088896507 11:114082752-114082774 GAGAGGGGCCTGGGGAGAGGGGG + Intronic
1088992529 11:114966251-114966273 GTTGGGGCAGTGGGGAGAGTGGG + Intergenic
1089198991 11:116711959-116711981 TTTTGGGGCTTGGGGAGAGAGGG - Intergenic
1089458363 11:118638848-118638870 GATCAGGCCCTGGGGAGACAGGG - Intronic
1089555854 11:119315716-119315738 GTTAGCCCGCTGGGGAGTGAGGG - Intronic
1090240180 11:125176223-125176245 GTCAGGGGCCTGGGGTGAGGAGG + Intronic
1090254896 11:125276682-125276704 GTTGGAGACCTGGGGAGAGAAGG + Intronic
1090491719 11:127169124-127169146 GGTAGGGTCAAGGGGAGAGAGGG - Intergenic
1090647048 11:128774762-128774784 GTTAGGGCCCCGGGGTCATATGG - Intronic
1090745120 11:129699215-129699237 GTCAGAGGCCTGGAGAGAGATGG - Intergenic
1202812679 11_KI270721v1_random:33984-34006 GTCAGGGCCCTGAGGAGGAAGGG + Intergenic
1091764070 12:3106931-3106953 CTTGGGGCCCTGGGGATGGAGGG + Intronic
1092955506 12:13545737-13545759 GTTAGGCCGCAGGGGAGAGGAGG - Exonic
1097194199 12:57234947-57234969 GTTTGATCCCTGGGGACAGAGGG + Exonic
1099894167 12:88624058-88624080 CTTAGGGTCCAGGGGAAAGAGGG + Intergenic
1102234577 12:111286276-111286298 GTTAAGGACTGGGGGAGAGAAGG - Intronic
1103215891 12:119201150-119201172 GCAAAGGCCCTGGGGTGAGAAGG - Intronic
1104384643 12:128339646-128339668 GTTTGGGACTTGGGGAGTGATGG - Intronic
1104595840 12:130119474-130119496 TCTGGGGCCCTGGGGAGAGCTGG + Intergenic
1104644442 12:130486864-130486886 GTTATGGTCCAGGGGAGAGGAGG - Intronic
1104911949 12:132244004-132244026 GTTAGGGGCATAGGGACAGACGG + Intronic
1106247628 13:27962733-27962755 GCTAGAGCCGAGGGGAGAGAGGG - Exonic
1108346754 13:49553736-49553758 TTTAAGGGCCTGGGGAGAGATGG + Intronic
1108444487 13:50493683-50493705 GCAAGGGCCTTGGGGACAGAGGG + Intronic
1111663684 13:91242010-91242032 GATAGAGTCCTGGGCAGAGAAGG + Intergenic
1112369416 13:98781931-98781953 GTTGGGGCTCTGGGGAAAGAAGG + Intergenic
1113025589 13:105937652-105937674 GTTAGGGACCTGGGCAGGAAGGG + Intergenic
1114523503 14:23352990-23353012 GCCAGGGCCCAGGGGAGGGAGGG + Intergenic
1116959377 14:50954356-50954378 GATAGGATCCTGGGGAGACAAGG - Intergenic
1117060186 14:51954324-51954346 GTTAGGGGAAGGGGGAGAGAGGG + Intronic
1117105770 14:52395724-52395746 GGAAGTGCCCTGGGGAGTGATGG - Intergenic
1118003065 14:61541397-61541419 GAGAGGGTCCTGGGGAGAAAGGG - Intronic
1120013463 14:79443964-79443986 GTTGGGGTGCTGGGTAGAGAAGG + Intronic
1120509800 14:85399371-85399393 GGTGGGGCTCTGGGGAGAGGAGG + Intergenic
1120889534 14:89479305-89479327 GTTAGGGCTCCCGAGAGAGAGGG - Intronic
1121788622 14:96681939-96681961 GTTAGAACCCTGGAGAGAGGCGG - Intergenic
1122153239 14:99735781-99735803 CTCAGGGACCTGGGGAGTGAAGG - Intergenic
1123067021 14:105623957-105623979 GTTAGTGCCGTGGGGGTAGATGG + Intergenic
1123071042 14:105642684-105642706 GTTAGTGCCGTGGGGGTAGATGG + Intergenic
1123076002 14:105667725-105667747 GTTAGTGCCGTGGGGGTAGATGG + Intergenic
1123090705 14:105740954-105740976 GTTAGTGCCGTGGGGGTAGATGG + Intergenic
1123096337 14:105768718-105768740 GTTAGTGCCGTGGGGGTAGATGG + Intergenic
1124040842 15:26101903-26101925 GTCAGGGATCTGGGGAGGGAAGG - Intergenic
1125766729 15:42141362-42141384 TTTAGGGCGCTGGGAAGAGAAGG + Exonic
1126070437 15:44861138-44861160 GATAGGGACTTAGGGAGAGAAGG + Intergenic
1126145754 15:45471425-45471447 GTTAGCGCCCTTGGCAGGGAAGG + Intergenic
1128345700 15:66851206-66851228 GTTAGGGCCCTGGGGCCATGCGG + Intergenic
1128758358 15:70198126-70198148 GTAAGGGCCCCGGGGAGGAAAGG + Intergenic
1129540785 15:76345985-76346007 GTTAGGGCGTGGGGGAGGGAGGG + Intergenic
1129694824 15:77734691-77734713 GCTGGGGCCCTGGGGAGTGTGGG - Intronic
1129900933 15:79149002-79149024 GTGAGGGGCCAGGGGAGAAATGG - Intergenic
1130146915 15:81281414-81281436 GTTAGGGCCGTGGGGCTGGATGG - Intronic
1130416219 15:83697022-83697044 GTTTGTGCTCTGGAGAGAGATGG + Intronic
1132600267 16:769978-770000 GAGAGGGCCCTGGGCAGAGGGGG + Intronic
1132755282 16:1481521-1481543 CTTAGGTCCCTGGGCTGAGAAGG - Intergenic
1133171704 16:3985966-3985988 GTTTCGCCCATGGGGAGAGAGGG - Intronic
1133340284 16:5031490-5031512 GTTAGGGGAAAGGGGAGAGATGG - Intronic
1134569901 16:15282156-15282178 GCAAAGGCCCTGGGGTGAGAAGG + Intergenic
1134732476 16:16473896-16473918 GCAAAGGCCCTGGGGTGAGAAGG - Intergenic
1134934961 16:18238070-18238092 GCAAAGGCCCTGGGGTGAGAAGG + Intergenic
1136315966 16:29454919-29454941 GCGAGGGCCCTGGTGAGAGGGGG + Exonic
1136378142 16:29877346-29877368 GGTCGGGCCCAGAGGAGAGAAGG + Exonic
1136430543 16:30194261-30194283 GCGAGGGCCCTGGTGAGAGGGGG + Exonic
1137044719 16:35644312-35644334 GAGAGGGGCATGGGGAGAGAAGG - Intergenic
1138208824 16:55145822-55145844 GTTAGGTTCCTGGAGAGTGAGGG - Intergenic
1138660862 16:58516114-58516136 GCTAGGGCCCTGGGGCGGGGCGG + Intronic
1140407909 16:74723336-74723358 GTTTGGACCCTGGGGACAAAGGG - Intronic
1141564419 16:84891753-84891775 GGTAGGCCCCTGGGGAGGGCAGG + Intronic
1141572394 16:84941845-84941867 GTCCGGGTCCTGGGGAGTGAGGG - Intergenic
1142290164 16:89190451-89190473 GTCAGGGTCCCGGGCAGAGAAGG - Exonic
1142386545 16:89768925-89768947 GTTTGGGGCCTGGGGTGAGTGGG + Intronic
1142433506 16:90043182-90043204 GTTATGGGCCTGTGGAGACAGGG - Exonic
1142601145 17:1053518-1053540 GACAGGAACCTGGGGAGAGAAGG - Intronic
1142695573 17:1630988-1631010 CTTAGTGCCCTGGGATGAGATGG - Intergenic
1143322906 17:6079629-6079651 GATGGGGCCCAGGGGAGGGAGGG - Intronic
1143731507 17:8885252-8885274 GGCAGGGCCCTGGGGAGGCACGG - Intronic
1143731556 17:8885383-8885405 GGTGGGGCCCTGGGGAGGCAGGG - Intronic
1143731857 17:8886087-8886109 GGTAGGCCCCTGGGGAGACGGGG - Intronic
1144853210 17:18254439-18254461 GTTAGGGCCCTGGGAAGTGAAGG + Intronic
1144994993 17:19261743-19261765 GTTAGGCCACTGAGGTGAGAGGG - Intronic
1145781804 17:27568447-27568469 GTGAGGGCCCTGGTGCCAGAGGG - Intronic
1146618452 17:34375861-34375883 GTGAGGGACCAGGGGAAAGAAGG + Intergenic
1147187709 17:38721864-38721886 GTGTGGGTCCTGGGGAGGGAGGG - Exonic
1147257860 17:39192774-39192796 CTGAGGCCCCTGGGGAGAGGTGG - Intronic
1147945249 17:44077089-44077111 GGTGGGGCCCTGGAGATAGAAGG + Exonic
1149628022 17:58093730-58093752 CTTAAGGCCTTTGGGAGAGATGG + Exonic
1149864415 17:60142709-60142731 GGTGTGGCCCTGGGGAGGGATGG - Intergenic
1150230889 17:63549917-63549939 AAAAGGGCCCTGGGAAGAGATGG + Intergenic
1150575751 17:66429684-66429706 GATAGGGCAGTGAGGAGAGAAGG - Intronic
1151575792 17:74952055-74952077 GTCAGGCCCCTGCGGGGAGAGGG + Exonic
1152006179 17:77682907-77682929 CTTGGGGGCCTGGGGCGAGAGGG - Intergenic
1152562198 17:81084150-81084172 CTGAGGGCCCTGGGGACACACGG - Intronic
1152572051 17:81125193-81125215 AGTAGGGCCCTGGGCAGGGATGG - Intronic
1152822766 17:82445614-82445636 GTTTGGCCCCTGGGGAGAGTGGG - Intronic
1153151670 18:2102222-2102244 AAAAGGGCCCTGGGGAGGGATGG - Intergenic
1155395987 18:25387335-25387357 GTGAGAGCCATGGGTAGAGATGG - Intergenic
1156440192 18:37178188-37178210 GGTGGGGACATGGGGAGAGAGGG - Intronic
1157481964 18:48060788-48060810 GTGATGGGCCTGGGGAGAGCAGG + Intronic
1158115838 18:53994115-53994137 GTCAGGGCTCTTGGGAGAAAGGG + Intergenic
1158481339 18:57824247-57824269 GATAGGGCACTGGGCAGAGTCGG - Intergenic
1158931868 18:62330680-62330702 GTCAGGGCAGTGGCGAGAGAAGG + Intronic
1159641035 18:70863510-70863532 TTTAGGGCCCTGGGAATCGAAGG + Intergenic
1160073084 18:75645411-75645433 GTTGTGGCCCCGGGGAGAGCAGG + Intergenic
1160969537 19:1761442-1761464 TTTAGGGCTCTGGGGAGCCACGG - Intronic
1160981020 19:1816636-1816658 GGTGGGTCCCTGGGGAGAGGCGG + Intronic
1161250250 19:3276254-3276276 GGCAGGGCCCTGGGGAGGGGTGG + Intronic
1161505756 19:4642652-4642674 GTAAAGGCCCTGGGGCAAGATGG + Intronic
1161978901 19:7620525-7620547 GGTAGGGCTGTGGGGAGGGACGG - Exonic
1162020054 19:7864227-7864249 GTCAGGCCGCTGGGGACAGATGG + Intronic
1162792514 19:13070340-13070362 GTTAAGGCCCTGGCTAGAGATGG + Intronic
1163786670 19:19278322-19278344 GTTGGGCTCCTGAGGAGAGAGGG - Intronic
1164753695 19:30674190-30674212 GATAGGGGCCTGGGTGGAGAAGG + Intronic
1164882750 19:31748720-31748742 GTTGAGGCACTGGAGAGAGATGG + Intergenic
1165773346 19:38390507-38390529 GGTAGGGACCTGGGGAGGGAGGG + Intronic
1166002449 19:39885892-39885914 ATCAGAGCCCTGGGGAGGGAGGG + Intronic
1166005233 19:39902144-39902166 ATCAGAGCCCTGGGGAGGGAGGG + Intronic
1166080075 19:40438481-40438503 GCAAAGGCCCTGGGGTGAGAAGG + Intergenic
1166982383 19:46639004-46639026 GGGAGGGCGCTGCGGAGAGAGGG + Intergenic
1167044053 19:47039656-47039678 GATAGGGCACTGGGGAGCCATGG + Intronic
1167163177 19:47780682-47780704 ATTGGGGCCCAGGGGAGAGAGGG - Intronic
1167706628 19:51084789-51084811 GAAAGGCACCTGGGGAGAGATGG - Intergenic
1167784822 19:51628085-51628107 TCTAGGGCTTTGGGGAGAGAAGG + Exonic
1168136772 19:54357058-54357080 GTCAGGGTCCTGGGGAGTGAAGG - Intronic
1168247458 19:55119928-55119950 GTGAGGGCCCGGTGGAGAGGAGG + Intergenic
1168254861 19:55159712-55159734 GTCTGGGTCCTGGGGAAAGAAGG + Intronic
1168368792 19:55813729-55813751 CTCAGGGCCCTGGGCAGAGGAGG + Intronic
925050979 2:815034-815056 GTTTGGGACCTGGGGAACGAGGG + Intergenic
925824832 2:7837499-7837521 GTTTGGTGCCTGGGGAGAGTGGG - Intergenic
926088512 2:10035223-10035245 GGCTGGGCACTGGGGAGAGAGGG - Intergenic
926299078 2:11589398-11589420 GGTGGGGCCCTGGGGAGAGAGGG + Intronic
927112885 2:19876912-19876934 GTTAGGACAGTGGGGAGATAGGG - Intergenic
929410552 2:41694043-41694065 TTCAGGGCCCTGGCAAGAGAGGG - Intergenic
929659996 2:43774465-43774487 GGGAGGCCCCTGGGGAGAGGAGG - Intronic
929918101 2:46153007-46153029 GTAAGGGCAGAGGGGAGAGAAGG - Intronic
930086870 2:47503834-47503856 CTTGAGGCCATGGGGAGAGAGGG - Intronic
932645641 2:73498546-73498568 GTGAGGGGTTTGGGGAGAGATGG - Intronic
932755871 2:74408881-74408903 GTAGGGCCCCTGGGTAGAGATGG + Intergenic
935560643 2:104555872-104555894 GTCAGGGCCCAGGGAACAGAAGG - Intergenic
935938843 2:108217599-108217621 GAAAGGGACCTGGGGACAGATGG - Intergenic
937287343 2:120761770-120761792 CACAGAGCCCTGGGGAGAGAAGG - Intronic
937962359 2:127469932-127469954 GTTTGCTCCCTGGGGAGAGAAGG - Intronic
938606335 2:132896481-132896503 GTTAGGACCCTGAGGTGATAAGG + Intronic
940357375 2:152758864-152758886 GTAAGGGCCCTGGACTGAGACGG - Intronic
940372858 2:152922169-152922191 GTTTGAACCCTGTGGAGAGATGG + Intergenic
943023774 2:182605142-182605164 GGCAGGGCCCAGGGCAGAGACGG - Intergenic
945811378 2:214554034-214554056 GTTAGTGGCCTGGGCAAAGATGG - Intronic
948117215 2:235502237-235502259 GTCTGGGGCCTGGGGAGGGAAGG + Intronic
1168883535 20:1226550-1226572 GAGAGGGGCGTGGGGAGAGAGGG - Intronic
1169198774 20:3697513-3697535 GTGGGGGCCCTGGGCAGAGAGGG + Intronic
1169410224 20:5362580-5362602 GCTAGGACCCTGGGGGAAGAGGG - Intergenic
1170701533 20:18708018-18708040 GTTAGGAGCTTGGGGAGACAGGG + Intronic
1170788819 20:19491175-19491197 GTGAGGGACCTGGGGAAAGAAGG - Intronic
1171956139 20:31465353-31465375 GTGAGGGACCTGAGGAGAGTGGG - Intergenic
1173090715 20:39968615-39968637 GATGGAGCCCTGGGGAGAGGAGG + Intergenic
1173226370 20:41164600-41164622 GTTAGAGCCCTGGTGAGCTAAGG - Intronic
1173606692 20:44336887-44336909 GACATGGCCCTGGGGTGAGATGG - Intergenic
1173737231 20:45370789-45370811 GGTAGGGCCCTGGGGACCTAGGG + Intronic
1173809893 20:45949311-45949333 GGTAGGGCCGTGGGGGGACAGGG - Exonic
1174070761 20:47897525-47897547 GCTGGAGCCCTGGGGGGAGATGG + Intergenic
1174153302 20:48501131-48501153 GCTGGAGCCCTGGGGGGAGATGG - Intergenic
1174263354 20:49313519-49313541 GTAAGGGCCCTGGGGACAGCAGG - Intergenic
1174874335 20:54210694-54210716 TTTGGGGGCCTGGGGAGTGAAGG - Intronic
1175207718 20:57324214-57324236 GCTAGGGGACTGGGGAGATAGGG + Intergenic
1175495272 20:59410243-59410265 GTTCGGGCTCTGGGGACTGAAGG + Intergenic
1175869853 20:62203710-62203732 GGCAGGTCCCTGGGGACAGAAGG - Intergenic
1178404865 21:32315860-32315882 GTGGGGGCCCAGGGGAGGGAGGG - Intronic
1178789809 21:35689377-35689399 GTTAGTGCCCTGGGGCCTGAAGG - Intronic
1178900366 21:36593264-36593286 GTCAGGGCCCCGGGGGCAGAGGG - Intergenic
1179588259 21:42387790-42387812 GGAAGGGGCCAGGGGAGAGAAGG + Intronic
1179612908 21:42564044-42564066 GTCAGGGCCCTGGGGAGGGACGG - Intronic
1180931930 22:19598194-19598216 GTCATGGACCTGGGGAGACAAGG - Intergenic
1181167128 22:20989757-20989779 GTGAGGGGCATGGGGAGACAGGG + Intronic
1181461599 22:23089110-23089132 GCTAGGGACCTGGAGAGTGAGGG + Intronic
1182441750 22:30368685-30368707 TGTAGGGCCTTGGGCAGAGAGGG - Intronic
1183196713 22:36358567-36358589 GGTATGGGTCTGGGGAGAGATGG - Intronic
1183629987 22:39027083-39027105 TCTAAGGCCCTCGGGAGAGATGG + Intronic
1183633423 22:39046948-39046970 TCTAAGGCCCTCGGGAGAGACGG + Intronic
1184353862 22:43964944-43964966 GCCAGGGCCCTGAGGAGACAGGG - Intronic
1184430271 22:44438288-44438310 GTGAAGGGCCTGGGGACAGATGG + Intergenic
1184574843 22:45355225-45355247 GAGAGGGCTTTGGGGAGAGAAGG - Intronic
1184928743 22:47663822-47663844 CTTAGGGCACTGGGGAGCCAAGG + Intergenic
1185072512 22:48664623-48664645 GTTAGGGCTCTGGTGAGCCAAGG - Intronic
1185213547 22:49585832-49585854 CTCAGGGCCCAGGGGTGAGAGGG + Intronic
1185288732 22:50013794-50013816 GTTCGGTCCCAGGGGAGGGAAGG + Intergenic
949269613 3:2199403-2199425 GGTAGGGACAGGGGGAGAGAAGG - Intronic
950208356 3:11097106-11097128 TTTAGGGCCCTGGGGAGCCATGG - Intergenic
950479303 3:13234956-13234978 GCTGAGGCCCTGGGAAGAGATGG + Intergenic
951006516 3:17622095-17622117 GGAAGGGAGCTGGGGAGAGATGG + Intronic
952784900 3:37143396-37143418 GTCAGGGGACAGGGGAGAGAAGG + Intronic
953575783 3:44112172-44112194 GTGAGGGCACTGGGGTGAGAGGG + Intergenic
953984513 3:47431042-47431064 GTGAGGGCTCTGGGGACAGAAGG + Intronic
954374138 3:50185354-50185376 GTTTGGGCCCTGGTGGGGGAAGG + Intronic
956952282 3:74296378-74296400 GTCAGGGGTCTGGGGAGTGATGG - Intronic
957197170 3:77083746-77083768 ATTAGGGACCTGGAGAAAGATGG + Intronic
957382492 3:79450322-79450344 GACAGGGTGCTGGGGAGAGAGGG + Intronic
959391041 3:105773936-105773958 GCTTGGGCCCTGAGCAGAGAGGG + Intronic
960945537 3:122963962-122963984 GTGGAAGCCCTGGGGAGAGAGGG - Intronic
961677681 3:128577662-128577684 GGCAGGGGCCTGGGCAGAGAGGG - Intergenic
963045625 3:141100830-141100852 GGCAGGGGCCTAGGGAGAGAAGG + Intronic
964306701 3:155348270-155348292 GTTAGGGCCTTGAAGACAGAAGG - Intergenic
968491861 4:894269-894291 GTTGGGGCCGTGGGGAGCGCAGG + Intronic
968701673 4:2060562-2060584 GCTGGGGCCCTGGGAAGAGGGGG + Intronic
968701940 4:2061510-2061532 GCCAGGGTCCTGGGGGGAGAGGG + Intronic
968731891 4:2273065-2273087 CTTCTGGCCCTGGGGAGATAGGG - Intronic
969568317 4:7993079-7993101 GTCAGCGCCCTGGGAACAGAAGG - Intronic
970433242 4:16008281-16008303 GTCAGAGCCCTGGGGAGGGAAGG - Intronic
971758652 4:30735635-30735657 ATTAGGGCCTTGAGGAAAGATGG + Intronic
976464247 4:85349558-85349580 CTTTGGGGCCTGGGGAGAAATGG - Intergenic
978918691 4:114155036-114155058 CATAGGGCCCTTGGGAGAAATGG - Intergenic
979233109 4:118368767-118368789 GTTGGAGGCCTGGGGAAAGAAGG - Intergenic
979950564 4:126887743-126887765 GTGAGTGCTCTGGGGAGGGAAGG + Intergenic
982436259 4:155385108-155385130 GTCTAGGCCCTGGGAAGAGAGGG - Intergenic
984991308 4:185384115-185384137 GGTGGAGCCCTGGGGAGTGACGG + Intronic
985630536 5:1011692-1011714 TTTTGGGGGCTGGGGAGAGAGGG - Intronic
985789362 5:1916879-1916901 GCTAGTGCCCTGGAGAGGGAGGG + Intergenic
986428024 5:7654150-7654172 GAAAGGGCCTTGGGAAGAGATGG + Intronic
986710178 5:10482983-10483005 GTCAGGGCACTGGGCAGGGAGGG - Intergenic
986719806 5:10552907-10552929 GTAAGGTGCCTGGGGAGGGAGGG + Intergenic
987248979 5:16079653-16079675 CTGAGGGCCCTGGGGAGAGGAGG - Intronic
990530570 5:56669609-56669631 GCAGGTGCCCTGGGGAGAGACGG - Intergenic
992643932 5:78794733-78794755 GTGAGGCCACTGGGGTGAGAGGG + Intronic
992752615 5:79874986-79875008 GAAAGGGCCCTGGGTAGAGCCGG + Intergenic
992781094 5:80128579-80128601 GAAAGGGAACTGGGGAGAGAGGG + Intronic
992911786 5:81402166-81402188 CTTAGTGCCCTGGGGACACAAGG + Intergenic
992986188 5:82232847-82232869 TTGATAGCCCTGGGGAGAGAAGG - Intronic
995402485 5:111757897-111757919 GCCAGGGCCGTGGGGAGAGGCGG + Intronic
997294756 5:132762442-132762464 CTCAGGGCCCTGGGGCCAGAGGG - Intronic
997380033 5:133429097-133429119 GTTAGGGCCCTCCGGAGAAGAGG - Intronic
997834887 5:137184363-137184385 GTGTGGGCCCAGGGGAGAGAAGG - Intronic
998026285 5:138819299-138819321 GTGTGGGCCCTGGGGAGGGGAGG + Intronic
998620812 5:143792425-143792447 GATATGGCCATGGGGAGTGAGGG - Intergenic
999382904 5:151134345-151134367 GTTGGGGCCCTGGGAAGGGCTGG - Intronic
1001101487 5:168818135-168818157 GCAAGGGCACTGTGGAGAGATGG - Intronic
1001539337 5:172526428-172526450 GTTAAGGCCATGGATAGAGATGG - Intergenic
1001539345 5:172526468-172526490 GTTAAGGCCATGGATAGAGATGG - Intergenic
1001589024 5:172852975-172852997 GTAATAGCCCAGGGGAGAGAGGG + Intronic
1002871379 6:1169930-1169952 GGGAGGGGCCTGGGGGGAGATGG + Intergenic
1002977015 6:2089897-2089919 GCTGGGGCCATGTGGAGAGAGGG + Intronic
1004020852 6:11774630-11774652 GTCAGGGGCGTGGGGAGGGAGGG + Intronic
1006293336 6:33157779-33157801 ATTGGGGCCCTGGGGAGAGAGGG - Intergenic
1006302292 6:33200098-33200120 GCTAAGGCCCTCGGGAGGGAGGG + Intronic
1006554973 6:34858398-34858420 CTTAGGTCTCTGGGGAGGGAGGG - Exonic
1007304253 6:40892003-40892025 AGGAGGGCCCTGGGGAGAGCAGG + Intergenic
1013402828 6:109815457-109815479 GTTAGAGCCCAGGCAAGAGAAGG - Intronic
1013463953 6:110400582-110400604 GATAAGGCCCTGGGGAGATGAGG - Intronic
1013896348 6:115093165-115093187 GTTAGGGGGTGGGGGAGAGAGGG - Intergenic
1015035232 6:128645400-128645422 GTAAGAGCACTGGGGAGTGAAGG + Intergenic
1016242413 6:141946118-141946140 GTTGGGGGCCTGGGGAGCAAGGG + Intergenic
1017544160 6:155433290-155433312 GTCAGGGCCTGAGGGAGAGATGG + Intronic
1019048886 6:169168229-169168251 TTTAGGGCCCTGGGGGGACAGGG - Intergenic
1019472016 7:1226089-1226111 GCCTGGGCCCTGGGCAGAGAGGG + Intergenic
1019515762 7:1439172-1439194 GTTAGCCCCCTGGGGAGACATGG - Intronic
1020021419 7:4871753-4871775 GTTGGTGCCCTGAGGAGAGGAGG - Intronic
1023860244 7:44214008-44214030 TTGAGGACCCTGGGGAGAGATGG + Exonic
1024263654 7:47590231-47590253 GTGAGGGGCAGGGGGAGAGAAGG - Intergenic
1025697903 7:63789655-63789677 GCTTGGGGCCCGGGGAGAGAGGG - Intergenic
1026618171 7:71926165-71926187 GTTAGGGGGTTGGGGAGAGGAGG - Intronic
1028984033 7:96996148-96996170 GTTAGCTCCCAGGAGAGAGAGGG - Intergenic
1029273263 7:99389732-99389754 GTCAGGGCCCTGGGGCGGCAGGG - Intronic
1029456479 7:100674728-100674750 CTGAGGGCCCTGGGGGGTGATGG + Intronic
1029597149 7:101543984-101544006 CCGGGGGCCCTGGGGAGAGAAGG - Exonic
1032238425 7:130143009-130143031 GTGCGGGCCCTGGAGAGAGCTGG - Intergenic
1033551232 7:142450248-142450270 GTGAGGGACTCGGGGAGAGAGGG - Intergenic
1033681692 7:143601431-143601453 TCCAGGGCCCTGGGGAGAGCTGG + Intergenic
1033703199 7:143860382-143860404 TCCAGGGCCCTGGGGAGAGCTGG - Exonic
1034630580 7:152527432-152527454 TTTTGGGGCGTGGGGAGAGATGG - Intergenic
1036001303 8:4608053-4608075 GTGAAGGCCCTGGGAGGAGATGG + Intronic
1036021136 8:4847981-4848003 GTTCGGGCCCTGGAAGGAGAGGG - Intronic
1037619688 8:20552378-20552400 GTGATAGGCCTGGGGAGAGAGGG + Intergenic
1037786378 8:21905832-21905854 ATTAGGGCCCTTGGGAAAGGTGG - Intergenic
1037937811 8:22927209-22927231 GTTGGGGTTCTGGGGAGAGGGGG + Intronic
1038871284 8:31496607-31496629 GTAAAGTCCCTGGGTAGAGAGGG - Intergenic
1039286046 8:36042004-36042026 GTGAGAGCTCTGTGGAGAGATGG + Intergenic
1040646346 8:49401658-49401680 ATGAGGACCCTGGGGAGAGCGGG + Intergenic
1042521042 8:69711263-69711285 CTTTGGGACCTGGGGACAGAGGG - Intronic
1042989551 8:74623357-74623379 GCTAAGGCCCTGGGGCAAGAAGG + Intronic
1044934903 8:97284496-97284518 GTTAGGGTCCTGGGGTAAGGTGG + Intergenic
1046986842 8:120397725-120397747 GATAGAGCCCTGGGGAGAGACGG + Intronic
1047615228 8:126557828-126557850 GTTAGGGCCCGAGGGTGGGAGGG - Intronic
1049298604 8:141856892-141856914 ATGAGGGCCCTGGGGAGAAAGGG + Intergenic
1049423547 8:142527208-142527230 GACAGGGCCCTGGGCACAGAGGG + Intronic
1049483953 8:142841742-142841764 GTTAGGGCCCTGGGGAGAGAGGG - Intronic
1049661159 8:143820270-143820292 GTCAGGCCCCTGAGGAGAGAGGG - Intronic
1049702824 8:144022850-144022872 GATATGGTCCTGAGGAGAGAGGG - Intronic
1049702996 8:144023463-144023485 GATATGGTCCTGAGGAGAGAGGG - Intronic
1049703174 8:144024147-144024169 GAGAGGGTCCTGGGGAAAGATGG - Intronic
1049703460 8:144025171-144025193 GAGAGGGCCCTGAGGAGAAAGGG - Intronic
1050120164 9:2299713-2299735 GTAAGGGCAAGGGGGAGAGAGGG + Intergenic
1050235515 9:3575000-3575022 GAAAGGACCCTGGGGAAAGAGGG + Intergenic
1052989707 9:34512039-34512061 GTTAGGGCTGTGGGCAGAGCAGG - Intronic
1053516290 9:38733535-38733557 GTGCTGGCCCTTGGGAGAGAAGG - Intergenic
1056596414 9:88011465-88011487 CCTAGTGCCCTGGGAAGAGAAGG - Intergenic
1058648622 9:107154354-107154376 GGTAGGGAGCTGGGCAGAGAAGG - Intergenic
1058758317 9:108104492-108104514 GAAAGGGCCCTGGGGAGAGGTGG + Intergenic
1060865497 9:126992097-126992119 GCTTGGGCTCTGGAGAGAGAAGG + Intronic
1061160545 9:128891591-128891613 GTCTGGGCCCTGGGGGCAGAAGG - Intronic
1061305414 9:129729909-129729931 GCAAGGGCCCTGGGGAGCCAAGG - Intergenic
1061395813 9:130342806-130342828 GTCAGGGGCATGGGGAGAGGCGG - Intronic
1061818303 9:133208858-133208880 GGTTGGGCCCTGTGGAGGGAGGG - Intronic
1062242149 9:135546500-135546522 GGTTGGGCCCTGTGGAGGGAGGG + Intronic
1062583408 9:137238030-137238052 GTGAGGCCCTTGTGGAGAGAGGG + Intergenic
1062623055 9:137431222-137431244 ATTAGGGACCTAGGGAGAGGAGG - Exonic
1185856707 X:3542826-3542848 ATGAGGGTCTTGGGGAGAGAGGG + Intergenic
1186553073 X:10527609-10527631 GGTAAGGCCCTGGGGTGAAAAGG - Intronic
1187519041 X:19997618-19997640 GTAAGGGGCCTGGGGAGGGAAGG - Intergenic
1189280652 X:39818359-39818381 GCAAGGGACCTGGGCAGAGATGG + Intergenic
1189564002 X:42220566-42220588 GTCAGGGCACTGGGAAAAGAGGG - Intergenic
1190477205 X:50840042-50840064 GGTAAGGGCCTGGAGAGAGAAGG - Intergenic
1190873025 X:54440535-54440557 GTTAGGGCCCGGGGCAGAACAGG + Intronic
1192564682 X:72153877-72153899 GTCAGGGGCCTGGGGAGACAGGG - Intergenic
1192587091 X:72327808-72327830 GTGAGTGCCCTGGAGACAGAGGG + Intergenic
1193298987 X:79866762-79866784 CTTATAGCCCTGGGGAGTGATGG - Intergenic
1194921516 X:99772109-99772131 GTGGGGGCCTGGGGGAGAGAGGG - Intergenic
1195221953 X:102753124-102753146 GTTAGGGGCACAGGGAGAGAGGG - Exonic
1196199095 X:112865329-112865351 GTTTGGGTCCTGGTGAGAGCAGG - Intergenic
1199622925 X:149715214-149715236 GTGAGGGCCCTGAGCACAGAGGG + Intronic
1200807468 Y:7447296-7447318 ATGAGGGTCTTGGGGAGAGAGGG - Intergenic