ID: 1049483954

View in Genome Browser
Species Human (GRCh38)
Location 8:142841743-142841765
Sequence GGTTAGGGCCCTGGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 454}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049483954_1049483962 0 Left 1049483954 8:142841743-142841765 CCTCTCTCCCCAGGGCCCTAACC 0: 1
1: 0
2: 5
3: 61
4: 454
Right 1049483962 8:142841766-142841788 TGCAGAAGATGTATGGCCAGAGG No data
1049483954_1049483960 -7 Left 1049483954 8:142841743-142841765 CCTCTCTCCCCAGGGCCCTAACC 0: 1
1: 0
2: 5
3: 61
4: 454
Right 1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG No data
1049483954_1049483968 26 Left 1049483954 8:142841743-142841765 CCTCTCTCCCCAGGGCCCTAACC 0: 1
1: 0
2: 5
3: 61
4: 454
Right 1049483968 8:142841792-142841814 AGTGACCAATGGAGCAAGCAGGG No data
1049483954_1049483963 15 Left 1049483954 8:142841743-142841765 CCTCTCTCCCCAGGGCCCTAACC 0: 1
1: 0
2: 5
3: 61
4: 454
Right 1049483963 8:142841781-142841803 GCCAGAGGCCCAGTGACCAATGG No data
1049483954_1049483969 29 Left 1049483954 8:142841743-142841765 CCTCTCTCCCCAGGGCCCTAACC 0: 1
1: 0
2: 5
3: 61
4: 454
Right 1049483969 8:142841795-142841817 GACCAATGGAGCAAGCAGGGAGG No data
1049483954_1049483970 30 Left 1049483954 8:142841743-142841765 CCTCTCTCCCCAGGGCCCTAACC 0: 1
1: 0
2: 5
3: 61
4: 454
Right 1049483970 8:142841796-142841818 ACCAATGGAGCAAGCAGGGAGGG No data
1049483954_1049483967 25 Left 1049483954 8:142841743-142841765 CCTCTCTCCCCAGGGCCCTAACC 0: 1
1: 0
2: 5
3: 61
4: 454
Right 1049483967 8:142841791-142841813 CAGTGACCAATGGAGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049483954 Original CRISPR GGTTAGGGCCCTGGGGAGAG AGG (reversed) Intronic
900113928 1:1020665-1020687 GGAGAGGGGCCTGGGGAGGGGGG + Intronic
900165579 1:1243157-1243179 GGAGAGAGCCCTGGGGAGGGTGG + Intronic
900245945 1:1636117-1636139 GGTCAGGAACCTGGGGGGAGAGG + Exonic
900253421 1:1683711-1683733 GGGTGGGGCCCTGGAGAGCGGGG - Intronic
900257170 1:1703260-1703282 GGTCAGGAACCTGGGGGGAGAGG + Exonic
900540476 1:3200192-3200214 AGTCAAGGGCCTGGGGAGAGGGG + Intronic
900642869 1:3695649-3695671 GGACAGGGCCCTGGGGCGGGGGG + Intronic
900667136 1:3823152-3823174 GGTGAGGGGCCTGGGGAGAAGGG - Exonic
901166396 1:7224771-7224793 GAGCAGGGCCCTGGGGAGCGGGG - Intronic
901530367 1:9849099-9849121 GGTGTGGGATCTGGGGAGAGCGG - Exonic
901631460 1:10650078-10650100 GGCTGGGGCCCTGCGGCGAGAGG + Intronic
901786342 1:11627331-11627353 GGGTAGGGCCCAGTGGGGAGTGG + Intergenic
902056784 1:13607306-13607328 GGTCAGTGTCCTGGGAAGAGAGG + Exonic
902225524 1:14994158-14994180 GGGTCGGGCCATGGGGAGAATGG + Intronic
902285953 1:15409236-15409258 GGTGCGGGGCCTCGGGAGAGAGG + Intergenic
902436399 1:16400698-16400720 GGTGAGGGCCCTGGGCAGGGTGG - Exonic
902471215 1:16648419-16648441 GGTTAGGGCCCTGGCGGGGCCGG - Intergenic
902487592 1:16759026-16759048 GGTTAGGGCCCTGGCGGGGCCGG + Intronic
902929620 1:19721703-19721725 GGCTTGGGCCCAGGGGAAAGAGG + Intronic
903044420 1:20554309-20554331 GGTTTGGACCCTGGGCAGGGTGG + Exonic
904503207 1:30929643-30929665 GGGTGAGGCCCTGGGGAGTGAGG - Intergenic
905249570 1:36639212-36639234 GGATAGAGCCCATGGGAGAGTGG - Intergenic
905387924 1:37616990-37617012 GTTTTGTGCTCTGGGGAGAGTGG - Intronic
905488759 1:38327265-38327287 AGTCAGGGCTCTGGGGAGATTGG + Intergenic
906460372 1:46031585-46031607 GGTGAGGCCCCTGGGGAGCTGGG + Exonic
906662088 1:47590237-47590259 GTCTAGGGCCCAGAGGAGAGAGG + Intergenic
907304843 1:53507710-53507732 GGAGTGGGCACTGGGGAGAGGGG + Intronic
907973839 1:59411964-59411986 TGTCAGTGCACTGGGGAGAGTGG - Intronic
911001752 1:93173047-93173069 GGTGGGGGACTTGGGGAGAGAGG + Intronic
911150118 1:94590350-94590372 GAGGAGGGCCCTGGGGAGAGAGG - Intergenic
911598106 1:99819394-99819416 GGTTTGAGCCCAGGGGACAGAGG + Intergenic
911745239 1:101434664-101434686 GGAAAAGGCCCTGTGGAGAGAGG - Intergenic
911795333 1:102068753-102068775 GGGGAGGGTCATGGGGAGAGAGG + Intergenic
912247926 1:107980132-107980154 GGTCAGGGACCTTGGGAGGGAGG - Intergenic
912460518 1:109827950-109827972 GGGTAGGGGGCTAGGGAGAGAGG + Intergenic
913962940 1:143353657-143353679 GGTTGCGGGGCTGGGGAGAGGGG - Intergenic
914057295 1:144179242-144179264 GGTTGCGGGGCTGGGGAGAGGGG - Intergenic
914121851 1:144787124-144787146 GGTTGCGGGGCTGGGGAGAGGGG + Intergenic
915280156 1:154816927-154816949 GGACAGGGTCCTGGGTAGAGGGG - Intronic
915331120 1:155112911-155112933 TGTCAGGGCCCTGTGGATAGAGG + Intergenic
915456626 1:156044757-156044779 GGTAGGGGACCTGGGGAGTGAGG - Intronic
915640878 1:157225080-157225102 GGAAAAGACCCTGGGGAGAGGGG - Intergenic
916019198 1:160777784-160777806 GGTCATGGCCCTGGGGCAAGAGG - Intergenic
916347828 1:163814273-163814295 AGTTAAGGACTTGGGGAGAGGGG - Intergenic
916426802 1:164688608-164688630 GGTCATGGCCCTGGTGTGAGTGG - Intronic
916735466 1:167603234-167603256 TGGCAGGGCTCTGGGGAGAGAGG + Intergenic
917735898 1:177920005-177920027 GGTTTGGGGCATGGGGAGGGTGG + Intergenic
917944412 1:179954659-179954681 GGTTAGGGCCATGTTGAGTGTGG - Intergenic
920263733 1:204706956-204706978 GGTTGGGGCCCTGGGGTCGGGGG - Intergenic
923003089 1:230023690-230023712 AGTTAGGGCCCTCAGGAGACTGG - Intergenic
923185065 1:231563781-231563803 GAGTAGAGCCCTGAGGAGAGTGG + Intronic
924510343 1:244724811-244724833 GCTTCTGCCCCTGGGGAGAGAGG - Intergenic
1062910961 10:1212100-1212122 AGTCAGGGCTCTGTGGAGAGTGG - Intronic
1063125664 10:3134582-3134604 GGTAAGGGGTCTGGGGAGGGAGG + Exonic
1065918165 10:30369150-30369172 GGACAGGGCCCTGGAGAGAGGGG + Intronic
1067047302 10:42991816-42991838 GGCTCGGGCCCGGGGCAGAGGGG + Intergenic
1067078825 10:43202754-43202776 GGTTAGGGGCGTGGTGGGAGCGG - Intronic
1067759920 10:49037158-49037180 GGTCAGCCCCCTGGGGAGAAAGG - Intronic
1068850132 10:61728878-61728900 GGCTGGGGCACTGGAGAGAGGGG + Intronic
1071567859 10:86680845-86680867 GGGCAGGGCAGTGGGGAGAGGGG + Intronic
1072613624 10:97035320-97035342 GGCTGGGGCCATGGGGAGGGGGG - Intronic
1073117129 10:101097514-101097536 TGATAGGGCCCTGGGGAGCAGGG + Intronic
1073176966 10:101562532-101562554 GGGCAGGGCCCTGGTGAGGGAGG + Intergenic
1074901177 10:117817573-117817595 GCTTTGGGCCCAGAGGAGAGAGG + Intergenic
1075523664 10:123163505-123163527 CTTTAAGGGCCTGGGGAGAGGGG - Intronic
1076096734 10:127738851-127738873 GGTTAAGGGTCTGGGGAGCGTGG - Exonic
1076170192 10:128312705-128312727 GGTCAGAGCCCTGGGGAAGGAGG - Intergenic
1076217804 10:128710411-128710433 GGTCTGGGGCCTGGGGACAGGGG - Intergenic
1076680186 10:132167808-132167830 GGTGAGGGCCGAGGGGTGAGGGG - Intronic
1077048311 11:555683-555705 GGGTCGGGGCCTGGGGAGGGAGG + Intronic
1077453484 11:2664509-2664531 GGTTTGGGCCCTGAGGAAACAGG - Intronic
1077694169 11:4378514-4378536 GGCTAGGGCCTTGGGCACAGTGG - Intergenic
1077860065 11:6170072-6170094 GGCTAGGGCCTTGGGCACAGTGG + Exonic
1081535029 11:43990042-43990064 GGTCAGGGCTCTGGGAAGGGAGG - Intergenic
1081577780 11:44329981-44330003 GGGTGTGGCCCTAGGGAGAGGGG + Intergenic
1081671210 11:44943642-44943664 TGGGAGGGCCCTGGGAAGAGGGG - Intronic
1081671947 11:44947405-44947427 GGGGAGGGGCATGGGGAGAGTGG - Intronic
1081821297 11:45998331-45998353 TGTTAGGGCCATGGATAGAGTGG + Intronic
1082848350 11:57744095-57744117 GGTTAGGGGCCTTGGGAGGGTGG - Exonic
1082891035 11:58139033-58139055 GGGTGGGGCCCTGGGAAGATGGG + Intronic
1083279692 11:61619305-61619327 GGGTGGGGCCTTGGGGAGGGAGG - Intergenic
1083729930 11:64647445-64647467 GGTTAGAGCCCTGCAGAGGGAGG - Intronic
1083794207 11:65005284-65005306 GGTAAGGGCCATGGGGAGTGTGG + Intergenic
1083814984 11:65127731-65127753 GGAAAGGGGCCTGGGGGGAGGGG + Exonic
1084430814 11:69110141-69110163 GGTTGGGATCCTTGGGAGAGAGG + Intergenic
1084572244 11:69966656-69966678 GGTTGGGGCGTTGGGGTGAGAGG + Intergenic
1084589030 11:70079451-70079473 GGGTCTGGCCCTGGGGAGGGTGG - Intronic
1084603944 11:70161994-70162016 AGTGAGGGCCCTGGGCAGTGAGG + Intronic
1084604058 11:70162302-70162324 AGTGAGGACCCTGGGCAGAGGGG + Intronic
1084637009 11:70399047-70399069 TATTAGGGCCCGAGGGAGAGGGG + Intronic
1084705878 11:70815722-70815744 GGTGGGGGCCCTGGGGAGGCTGG + Intronic
1084891093 11:72237536-72237558 GGTGAGGGGCCTGGGGGCAGTGG - Exonic
1085021587 11:73213473-73213495 GGTCAGAGGCCTGGGGAGTGGGG + Intergenic
1085305875 11:75485892-75485914 TGCTAGGGCCCTGGGGAAGGGGG + Intronic
1085322418 11:75583316-75583338 GGATAGTGCCCTGGCGAGGGTGG - Intergenic
1085725627 11:78952333-78952355 GGATAGGGCTCTGGGAAGAAGGG + Intronic
1087721022 11:101665432-101665454 GGATAGGGCACTGGGCAGAATGG - Intronic
1088511344 11:110578988-110579010 GAATAGGGGCCTGAGGAGAGAGG - Exonic
1088896506 11:114082751-114082773 GGAGAGGGGCCTGGGGAGAGGGG + Intronic
1088916049 11:114228710-114228732 GGCTGGCGGCCTGGGGAGAGTGG - Intronic
1088992528 11:114966250-114966272 GGTTGGGGCAGTGGGGAGAGTGG + Intergenic
1089136892 11:116256393-116256415 GATTGGGGCCCTGGGAGGAGGGG - Intergenic
1089198992 11:116711960-116711982 GTTTTGGGGCTTGGGGAGAGAGG - Intergenic
1089255680 11:117192721-117192743 GCTGAGGACCCAGGGGAGAGTGG + Intronic
1089301468 11:117501576-117501598 GGGCAGGTCACTGGGGAGAGTGG + Intronic
1089644566 11:119870153-119870175 GGTCAGAGCCCTGGGGAGTGTGG - Intergenic
1090491720 11:127169125-127169147 GGGTAGGGTCAAGGGGAGAGAGG - Intergenic
1090510500 11:127369605-127369627 AGTTAGGGCTCCGGGGTGAGGGG + Intergenic
1091690007 12:2589533-2589555 GGATAGTGCCCTGAGGCGAGAGG + Intronic
1091915353 12:4269272-4269294 GGTCCGGGCCCTGGGCAGCGCGG - Intergenic
1092386047 12:8036553-8036575 GCACAGGGCCCTGGAGAGAGAGG + Intronic
1092386315 12:8038195-8038217 GGGTGGGACCTTGGGGAGAGGGG + Intronic
1095962856 12:47846290-47846312 GCTCAGGGACCTGGGGAGCGGGG - Intronic
1096406998 12:51351115-51351137 GGTTGGGGCCCAGTTGAGAGAGG - Intergenic
1096968833 12:55649162-55649184 GGTGAGGGGACAGGGGAGAGGGG + Intergenic
1096981129 12:55728724-55728746 GGTCAGAGCCCAGGGGAAAGGGG - Intronic
1101017725 12:100519332-100519354 GGATTGGGCACTGGGGAGTGGGG + Intronic
1102418127 12:112782087-112782109 GGGATGGGTCCTGGGGAGAGTGG + Intronic
1102506869 12:113389312-113389334 GGGTATGGCCCTGAGGTGAGGGG - Exonic
1102646852 12:114409218-114409240 GGTCAGGCCCGCGGGGAGAGCGG + Intergenic
1102779631 12:115552970-115552992 GGTTGGGGACCTGGGGAGAGGGG - Intergenic
1102856376 12:116298154-116298176 GGCTTGGGGCCTGGGGAGAAAGG + Intergenic
1103246074 12:119458637-119458659 CTTTAGGGCCCTTGGGAGGGAGG + Intronic
1103479481 12:121241756-121241778 GGTAAGGTCCCTGGGGAGGGGGG + Intronic
1103494364 12:121350162-121350184 GGTGAGGGGCATGGGAAGAGGGG - Intronic
1106247629 13:27962734-27962756 GGCTAGAGCCGAGGGGAGAGAGG - Exonic
1106624910 13:31410523-31410545 GGTGAGGGCCCTGCGGTGGGAGG + Intergenic
1106957615 13:34958600-34958622 AGTTTAGGCCCTGGGGAGACTGG + Intronic
1108427114 13:50313469-50313491 GGTTGGGGGGCAGGGGAGAGGGG + Intronic
1112974925 13:105305460-105305482 AGTGAGGGAGCTGGGGAGAGGGG + Intergenic
1113654026 13:112057085-112057107 GGTAAAGGCTCTCGGGAGAGGGG + Intergenic
1114523502 14:23352989-23353011 GGCCAGGGCCCAGGGGAGGGAGG + Intergenic
1114555344 14:23559050-23559072 GCTTAGCGGCCAGGGGAGAGGGG - Exonic
1117114081 14:52492209-52492231 GGAAAGGGACCTGGGGTGAGGGG - Intronic
1117158691 14:52966152-52966174 GGTTGGGGGCGTGGTGAGAGGGG - Intergenic
1117732684 14:58739654-58739676 GGTTTGTGTCCTGGGGTGAGGGG + Intergenic
1118440735 14:65809216-65809238 GATTAGGGCCTTGGGGTGGGTGG + Intergenic
1118899196 14:69972592-69972614 GCTGAGGGCTCTGGGGAGAAAGG + Intronic
1119109416 14:71957600-71957622 GTTCAGAGCCCTGGTGAGAGAGG + Intronic
1119217832 14:72882797-72882819 GGTGAGGGGAGTGGGGAGAGGGG - Intronic
1119257426 14:73210374-73210396 GGTTATGGCACTGGGAAGACAGG + Intronic
1119780091 14:77271431-77271453 GTTGAGGGGCCTGTGGAGAGGGG - Intergenic
1119892660 14:78194607-78194629 GCCTAGGGCCTTGGGAAGAGTGG + Intergenic
1120081032 14:80216464-80216486 GGTTTGGGCAGTGGGGAGAGGGG - Intronic
1121075527 14:91065144-91065166 GGTTAGGGATCTGAGGAGAGTGG + Intronic
1121109617 14:91303493-91303515 GGGGTGGGGCCTGGGGAGAGGGG - Intronic
1121369783 14:93346814-93346836 GGTTGGGGCTCAGGGGAGGGTGG + Intronic
1122097279 14:99381202-99381224 GGGTGGGGCCCGGGGGCGAGAGG - Intergenic
1122211843 14:100178596-100178618 GCTTAGTGCCCTGGGGAGCCTGG + Intergenic
1122211910 14:100178868-100178890 GGTTGGGCCCCTGGAGAGTGGGG + Intergenic
1122270817 14:100567841-100567863 GGTGAGGGCGCTGGGGAAGGCGG - Intronic
1122894284 14:104748308-104748330 GGGTAAGCTCCTGGGGAGAGGGG + Intergenic
1123472933 15:20568321-20568343 GGAAAGGGCCCTGGAGAGAGGGG - Intergenic
1123645072 15:22432032-22432054 GGAAAGGGCCCTGGAGAGAGGGG + Intergenic
1123666362 15:22611807-22611829 GGAAAGGGCCCTGGAGAGAGGGG + Intergenic
1123733236 15:23163313-23163335 GGAAAGGGCCCTGGAGAGAGGGG - Intergenic
1123751369 15:23360688-23360710 GGAAAGGGCCCTGGAGAGAGGGG - Intronic
1124283739 15:28384606-28384628 GGAAAGGGCCCTGGAGAGAGGGG - Intronic
1124298958 15:28527007-28527029 GGAAAGGGCCCTGGAGAGAGGGG + Intronic
1124320181 15:28706221-28706243 GGAAAGGGCCCTGGAGAGAGGGG + Intronic
1124482331 15:30089196-30089218 GGAAAGGGCCTTGGAGAGAGGGG - Intronic
1124488789 15:30141298-30141320 GGAAAGGGCCTTGGAGAGAGGGG - Intronic
1124521248 15:30408010-30408032 GGAAAGGGCCCTGGAGAGAGGGG + Intronic
1124537413 15:30558207-30558229 GGAAAGGGCCTTGGAGAGAGGGG - Intronic
1124543872 15:30610262-30610284 GGAAAGGGCCTTGGAGAGAGGGG - Intronic
1124563827 15:30797695-30797717 GGAAAGGGCCCTGGAGAGAGGGG - Intergenic
1124754739 15:32397025-32397047 GGAAAGGGCCTTGGAGAGAGGGG + Intronic
1124761243 15:32449380-32449402 GGAAAGGGCCTTGGAGAGAGGGG + Intronic
1124777391 15:32599683-32599705 GGAAAGGGCCTTGGAGAGAGGGG - Intronic
1124959433 15:34383546-34383568 GGAAAGGGCCCTGGAGAGAGGGG + Intronic
1124976059 15:34529767-34529789 GGAAAGGGCCCTGGAGAGAGGGG + Intronic
1127220580 15:56876254-56876276 GGTAGGGGCTCTGGAGAGAGAGG + Intronic
1127328795 15:57919184-57919206 GGTGAGGGTCCTGAGGAGTGGGG - Intergenic
1127346596 15:58107277-58107299 GGTGAGGGCCTAGGGGACAGGGG - Intronic
1127773288 15:62247130-62247152 GGAAAGGGCCCTGCAGAGAGGGG + Intergenic
1127774603 15:62255142-62255164 GGAAAGGGCCCTGCAGAGAGGGG + Intergenic
1127976635 15:64002141-64002163 GCTCAGGGCCCTGGGGAGAGTGG + Intronic
1128383625 15:67131658-67131680 AGTTAGGGCTCTCGAGAGAGAGG - Intronic
1128480886 15:68036786-68036808 GGGTAGGCCCCTGGGAGGAGTGG - Intergenic
1129037834 15:72661720-72661742 GGAAAGGGCCCTGGAGAGAGGGG - Intronic
1129212055 15:74075507-74075529 GGAAAGGGCCCTGGAGAGAGGGG + Intronic
1129363143 15:75037038-75037060 GTTTTGGGAGCTGGGGAGAGTGG + Intronic
1129398348 15:75265578-75265600 GGAAAGGGCCCTGGAGAGAGGGG - Intronic
1129401956 15:75289853-75289875 GGAAAGGGCCCTGGAGAGAGGGG - Intronic
1129475544 15:75782541-75782563 GGAAAGGGCCCTGGAGAGAGGGG - Intergenic
1129694825 15:77734692-77734714 CGCTGGGGCCCTGGGGAGTGTGG - Intronic
1129696150 15:77741608-77741630 GTGGTGGGCCCTGGGGAGAGCGG - Intronic
1129729181 15:77919828-77919850 GGAAAGGGCCCTGGAGAGAGGGG + Intergenic
1129737718 15:77975296-77975318 GGCGGGGGCCCTGGGGAGGGCGG - Intergenic
1129839327 15:78734121-78734143 GGAAAGGGCCCTGGAGAGAGGGG - Intergenic
1129881020 15:79006012-79006034 GGCTTGGTTCCTGGGGAGAGGGG + Intronic
1130059102 15:80556898-80556920 TGTGAGAGCCCTGTGGAGAGAGG - Intronic
1130472561 15:84237719-84237741 GGCCAGGGTCCTGGGGACAGGGG + Intronic
1130484279 15:84389865-84389887 GGCCAGGGTCCTGGGGACAGGGG + Intergenic
1130484546 15:84391411-84391433 GGAAAGGGCCCTGCAGAGAGGGG - Intergenic
1130491717 15:84435839-84435861 GGCCAGGGTCCTGGGGACAGGGG - Intergenic
1130503332 15:84514879-84514901 GGCCAGGGTCCTGGGGACAGGGG - Intergenic
1130550522 15:84887667-84887689 GTTTAGGGGCCCGGGGAAAGGGG - Intronic
1131282867 15:91034799-91034821 GGAAAGGGCCCTGGAGAGAGGGG + Intergenic
1131293857 15:91130235-91130257 GGTTAGGGCAACTGGGAGAGAGG + Intronic
1132507493 16:318844-318866 GGCTGGGGCCTTGGTGAGAGCGG + Intronic
1132600266 16:769977-769999 TGAGAGGGCCCTGGGCAGAGGGG + Intronic
1132691185 16:1182607-1182629 GGCCAGGCCCCTGGGGAGAGGGG + Intronic
1133171705 16:3985967-3985989 GGTTTCGCCCATGGGGAGAGAGG - Intronic
1136315965 16:29454918-29454940 GGCGAGGGCCCTGGTGAGAGGGG + Exonic
1136430542 16:30194260-30194282 GGCGAGGGCCCTGGTGAGAGGGG + Exonic
1136608554 16:31352710-31352732 GGAGAGGGCCCTGGAGAAAGGGG - Intergenic
1136620889 16:31427850-31427872 GGGTAGGGCTGTGGAGAGAGCGG + Exonic
1137279044 16:46959542-46959564 GTTTAGGGCACTAGGGACAGTGG - Intronic
1137592588 16:49702774-49702796 GGCTGGGGCCCTGGGGAGGCTGG + Intronic
1137592703 16:49703592-49703614 TGTGAGGGGCCTTGGGAGAGTGG - Intronic
1137874301 16:51980975-51980997 AGGTTGGGTCCTGGGGAGAGGGG + Intergenic
1138046251 16:53728709-53728731 GGAGAGGGCCCTGGGAAGATGGG + Intronic
1138108900 16:54307641-54307663 GGTTGGAGCCCTGGAGAGACAGG + Intergenic
1138445320 16:57059606-57059628 GGAGAGGGCCCAGGGAAGAGGGG - Intronic
1138450028 16:57088178-57088200 GGTTAGGAGCCTGGGGCCAGAGG + Intergenic
1138465567 16:57187050-57187072 GGTAAGGACCTTGGGGAGAGGGG + Exonic
1138480672 16:57301141-57301163 GGTTTGGGCACTGGGGACATAGG - Intergenic
1140407910 16:74723337-74723359 GGTTTGGACCCTGGGGACAAAGG - Intronic
1141572395 16:84941846-84941868 GGTCCGGGTCCTGGGGAGTGAGG - Intergenic
1141785899 16:86200789-86200811 GGCTAGAGACCTGGGGAGAGGGG - Intergenic
1141786083 16:86201769-86201791 GGCTAGATACCTGGGGAGAGCGG + Intergenic
1142189885 16:88712921-88712943 GGTCAGGGCCCGGGGAAGGGGGG - Intronic
1142189922 16:88713006-88713028 GGTCAGGGCCCGGGGAAGGGGGG - Intronic
1142189941 16:88713049-88713071 GGTCAGGGCCCGGGGAAGGGGGG - Intronic
1142189977 16:88713132-88713154 GGTCAGGGCCCGGGGAAGGGGGG - Intronic
1142189994 16:88713173-88713195 GGTCAGGGCCCGGGGAAGGGGGG - Intronic
1142190013 16:88713216-88713238 GGTCAGGGCCCGGGGAAGGGGGG - Intronic
1142386544 16:89768924-89768946 TGTTTGGGGCCTGGGGTGAGTGG + Intronic
1142413224 16:89926471-89926493 GCTTGGGGTCCTGGGGAAAGCGG - Intronic
1143026363 17:3944069-3944091 GGCTGGAGCCTTGGGGAGAGGGG - Intronic
1143107245 17:4535928-4535950 GGGCAGGGCCCAGGGGAGAGAGG + Intronic
1143322907 17:6079630-6079652 GGATGGGGCCCAGGGGAGGGAGG - Intronic
1143350477 17:6284516-6284538 GGTTTGGGGCCTGGGAAGTGAGG + Intergenic
1143731858 17:8886088-8886110 AGGTAGGCCCCTGGGGAGACGGG - Intronic
1144265202 17:13562133-13562155 GGTCATGGCCATGGGGAGAAGGG - Intronic
1144830251 17:18127175-18127197 GCCTAGGGTCCTGGGGAGACAGG - Intronic
1145793622 17:27643383-27643405 GGTTAGGGCCCTGCCAAGATGGG - Intronic
1145808433 17:27750939-27750961 GGTTAGGGCCCTGCCAAGATGGG - Intergenic
1145828481 17:27895732-27895754 GGTGAGGGCCATGGGGTGATGGG + Intergenic
1146656191 17:34636586-34636608 GGTGAGAGTCCTGGGGAGTGAGG + Intronic
1147137811 17:38444187-38444209 GCTGAGGGGCCTGGGGAGCGAGG + Intronic
1147166360 17:38595705-38595727 GGCTTGTGGCCTGGGGAGAGGGG - Intronic
1147905063 17:43817224-43817246 GGGTAGGGCCCCGTGCAGAGAGG - Intronic
1148124711 17:45230749-45230771 GGCTGGGGCTATGGGGAGAGGGG + Intronic
1148257543 17:46148922-46148944 GGTTAGGAGTCTAGGGAGAGGGG - Intronic
1148492212 17:48030609-48030631 GGTTAGGGAGCTTGGGACAGGGG - Intronic
1148673843 17:49433410-49433432 GCTTAGTGACCTGGGGAGAATGG - Intronic
1148733541 17:49851824-49851846 GGTGGGGACCCTGGGGACAGGGG + Intergenic
1149431169 17:56596299-56596321 CCTTAGGTCCCCGGGGAGAGGGG - Intergenic
1150479257 17:65496926-65496948 GGGTGGGCCCCTGGGGAGCGGGG + Intergenic
1152730333 17:81966920-81966942 GCTCAAGGCCCTGGGGGGAGGGG - Intergenic
1152802860 17:82339970-82339992 GGGGAGGGCACTGGGGGGAGAGG - Intergenic
1152822767 17:82445615-82445637 GGTTTGGCCCCTGGGGAGAGTGG - Intronic
1152895335 17:82907662-82907684 GGTTAGGGTCTTGGGGAGTGTGG + Intronic
1153624244 18:7008157-7008179 TTTTGGGGCACTGGGGAGAGAGG + Intronic
1156182975 18:34627444-34627466 TGATAGGGCCCTGAGAAGAGTGG - Intronic
1157401531 18:47392680-47392702 GGATAGAGCCCTGGGGAGATGGG + Intergenic
1160005385 18:75064845-75064867 GGTCATGGCCGTGGGGAAAGTGG + Exonic
1160309134 18:77772538-77772560 GGATTGGGCACTGTGGAGAGGGG + Intergenic
1160718004 19:585101-585123 AGTTAGTGCCCAGGGGTGAGGGG - Intergenic
1161378083 19:3950359-3950381 TGGTAGGGCCCTGGGGTGGGGGG - Intergenic
1161606856 19:5219862-5219884 GGTCAGGGCCCTGGGGAATGGGG + Intronic
1161769918 19:6225506-6225528 GGCTAGGGCTCGGGGCAGAGGGG + Intronic
1161796964 19:6392894-6392916 TGCTAGGGCCCTGCGGAAAGAGG + Exonic
1162054231 19:8053155-8053177 GGGTGGGGGCATGGGGAGAGGGG - Intronic
1162379069 19:10321302-10321324 CTGGAGGGCCCTGGGGAGAGGGG - Intronic
1162578662 19:11514212-11514234 GGCGAGGGACCTGGGGAGGGAGG + Exonic
1162605357 19:11702601-11702623 GGTCAGGGCTCTGTAGAGAGTGG - Intergenic
1163273273 19:16266911-16266933 GGTCAGGGCATTGGGGAGGGGGG + Intergenic
1163304839 19:16471653-16471675 GGTCCGGGCCCTGGGCGGAGAGG + Intronic
1163493158 19:17629156-17629178 TGTCAGGGCCCTGGGGAGAAGGG + Intronic
1163664767 19:18598134-18598156 GGAGGGGGCCCTGGGGAGAGGGG - Intronic
1163728976 19:18939040-18939062 GGTTTGGCCCCTAGGGAGAGAGG + Exonic
1164156310 19:22599666-22599688 GGAAAGGGCCCTGGAGAGGGGGG - Intergenic
1164526155 19:29015081-29015103 GGCCGGGGCTCTGGGGAGAGCGG - Intergenic
1165413844 19:35679054-35679076 GGCTACAGCCCTTGGGAGAGAGG - Intergenic
1165707308 19:37985822-37985844 GGTAAGGGCCCTGGGAAGGCTGG - Intronic
1165773345 19:38390506-38390528 GGGTAGGGACCTGGGGAGGGAGG + Intronic
1165782091 19:38440878-38440900 GGAGAGGGGCCTGGGGACAGGGG + Intronic
1165786506 19:38464863-38464885 GGTCAGGGCTCTGGGGTCAGAGG + Intronic
1165898296 19:39156281-39156303 GGATAGAGCCCTGGGGAGAGGGG - Intronic
1166002448 19:39885891-39885913 GATCAGAGCCCTGGGGAGGGAGG + Intronic
1166005232 19:39902143-39902165 GATCAGAGCCCTGGGGAGGGAGG + Intronic
1166083286 19:40458347-40458369 GGGGAGGGCCGTGGGCAGAGGGG + Intronic
1166305246 19:41933892-41933914 ACTTAGGGAACTGGGGAGAGGGG + Intergenic
1166571544 19:43799825-43799847 GCTTGGGACCCTGGGGAGAGAGG + Exonic
1166666268 19:44682432-44682454 TGTGAGGCCCCTGGGCAGAGGGG - Intronic
1166982382 19:46639003-46639025 GGGGAGGGCGCTGCGGAGAGAGG + Intergenic
1167108868 19:47447363-47447385 GGGACGGGGCCTGGGGAGAGCGG - Intronic
1167163178 19:47780683-47780705 CATTGGGGCCCAGGGGAGAGAGG - Intronic
1167237959 19:48326289-48326311 AGTCAGGGTTCTGGGGAGAGAGG + Intronic
1167637078 19:50661519-50661541 GCTGAGGGGCCTGGAGAGAGTGG + Intronic
1202696778 1_KI270712v1_random:131915-131937 GGTTGCGGGGCTGGGGAGAGGGG - Intergenic
1202703609 1_KI270713v1_random:5214-5236 GGTTAGGGCCCTGGCGGGGCCGG - Intergenic
925050978 2:815033-815055 GGTTTGGGACCTGGGGAACGAGG + Intergenic
925824833 2:7837500-7837522 TGTTTGGTGCCTGGGGAGAGTGG - Intergenic
926088513 2:10035224-10035246 GGGCTGGGCACTGGGGAGAGAGG - Intergenic
926299077 2:11589397-11589419 AGGTGGGGCCCTGGGGAGAGAGG + Intronic
926743179 2:16128935-16128957 GGTGAGGGGGCTGGAGAGAGAGG + Intergenic
927112886 2:19876913-19876935 GGTTAGGACAGTGGGGAGATAGG - Intergenic
927856381 2:26530257-26530279 GCTAAGGGACCTGGGGAGGGAGG + Intronic
928173109 2:29016113-29016135 GAGTGGGCCCCTGGGGAGAGAGG - Intronic
928660827 2:33500332-33500354 GATTTGGGCCCAGGAGAGAGGGG + Intronic
929217856 2:39435467-39435489 GCTTAGGGTACTGGGGAGAGGGG - Intronic
929234708 2:39593674-39593696 GGTTGGGGCCATGGGGAAGGAGG + Intergenic
929583661 2:43100719-43100741 GGCTGGGGGCTTGGGGAGAGGGG - Intergenic
931259013 2:60600385-60600407 GGTTTGGGCCCATGGGAGAATGG + Intergenic
932298407 2:70645631-70645653 GGATAGCGCCCTGGGGTGACAGG + Intronic
933909759 2:86929800-86929822 GGCTGGAGCCCTGAGGAGAGGGG - Intronic
934022969 2:87973588-87973610 GGCTGGAGCCCTGAGGAGAGGGG + Intergenic
934277931 2:91588929-91588951 GGTTGCGGGGCTGGGGAGAGGGG - Intergenic
934989821 2:98913397-98913419 GGGCAGGTCCCTGGGCAGAGAGG + Intronic
935847921 2:107187199-107187221 GCAGAGGCCCCTGGGGAGAGTGG - Intergenic
937336528 2:121065715-121065737 GGCGAGGGCTCTGTGGAGAGAGG + Intergenic
938000736 2:127733922-127733944 GGTTAGGGCAGTGGTGGGAGGGG + Intronic
938627358 2:133125467-133125489 GGTTAGAGGAGTGGGGAGAGTGG + Intronic
938743170 2:134252137-134252159 GGCTGGAGCCCTGGGGAAAGTGG + Intronic
939468460 2:142588270-142588292 GGGTAGGGGGCTGGGGAGTGAGG + Intergenic
940318588 2:152350172-152350194 GGTAAGAGCCCTCGGGAGGGAGG + Intronic
940807912 2:158208527-158208549 TGTTAGGGCCCTGGGCAGGGTGG + Intronic
947096421 2:226572343-226572365 GGGCAGGGCCGTGGGGGGAGGGG - Intergenic
947584107 2:231341975-231341997 GCTTTGGGGTCTGGGGAGAGAGG - Intronic
948147308 2:235717152-235717174 GGTGAGTGACGTGGGGAGAGTGG - Intronic
948795386 2:240399802-240399824 GGTCAGGGCCCTTGGCAGAATGG - Intergenic
948859013 2:240743920-240743942 GGTTAGCGCCCTGGGTCGGGGGG - Exonic
948901597 2:240959213-240959235 GGCCAGGACCCTGGAGAGAGAGG - Intronic
949047238 2:241877692-241877714 GGTAGGGGCCCTGGGGAGGTCGG - Intergenic
1168883536 20:1226551-1226573 GGAGAGGGGCGTGGGGAGAGAGG - Intronic
1169198773 20:3697512-3697534 TGTGGGGGCCCTGGGCAGAGAGG + Intronic
1170073148 20:12390607-12390629 GGTGAGGGAACTGGGGAGCGAGG + Intergenic
1170694725 20:18647916-18647938 GGGCAGGGGCCAGGGGAGAGTGG + Intronic
1170701532 20:18708017-18708039 GGTTAGGAGCTTGGGGAGACAGG + Intronic
1170760364 20:19243817-19243839 GGGGAAGGCTCTGGGGAGAGAGG - Intronic
1171329196 20:24322739-24322761 GTTAATGGCCCTGGAGAGAGAGG - Intergenic
1171956140 20:31465354-31465376 GGTGAGGGACCTGAGGAGAGTGG - Intergenic
1172219385 20:33262749-33262771 GGTTAGGGGCCTGGAGAGCTTGG - Intergenic
1172523600 20:35584327-35584349 AGTTAGGGGTCTGGGGAGTGGGG - Intergenic
1172993678 20:39054228-39054250 GAGTAGAGCCCTGAGGAGAGGGG + Intergenic
1173827976 20:46059175-46059197 GGTCAGGGCCCTGGGGCTGGAGG - Intronic
1174443469 20:50574778-50574800 GGTTTGGGCACTGTGGTGAGCGG + Intronic
1175207717 20:57324213-57324235 GGCTAGGGGACTGGGGAGATAGG + Intergenic
1175809892 20:61852295-61852317 GGTTAGTCCCCAGGGGAGATGGG - Intronic
1175913720 20:62416156-62416178 GCTTCGGGGCCTGGGGTGAGTGG - Exonic
1176173612 20:63707593-63707615 GGGGACGGCCCTGGGGGGAGCGG + Intronic
1176223312 20:63980034-63980056 GCTCAGTGCCCGGGGGAGAGGGG + Intronic
1176308614 21:5137465-5137487 GGTGAAGGCCCTGGGTGGAGAGG + Exonic
1179015955 21:37594694-37594716 GGGAAGGGGCCTGGTGAGAGGGG - Intergenic
1179420918 21:41236237-41236259 GGGTAGAGCACTGTGGAGAGAGG - Intronic
1179848445 21:44124567-44124589 GGTGAAGGCCCTGGGTGGAGAGG - Exonic
1180258689 21:46651343-46651365 AGGGAGGGCCCTGGGGAGGGTGG + Intronic
1180835709 22:18928548-18928570 GGTTGGGGAGCTGGGGAGGGGGG - Intronic
1181167127 22:20989756-20989778 GGTGAGGGGCATGGGGAGACAGG + Intronic
1181471311 22:23141909-23141931 GGCTAGGGGCCCGGGGACAGGGG - Intronic
1181985784 22:26799121-26799143 GGGGGGGGCTCTGGGGAGAGAGG - Intergenic
1182429611 22:30292061-30292083 GGTTAGGGTGCTGGTGTGAGGGG - Exonic
1183252881 22:36742854-36742876 GGCAAGGGCCCTGAGGAGGGAGG + Intergenic
1183753679 22:39738841-39738863 GGTTAGGGGGATGGGGAGGGAGG + Intergenic
1183949423 22:41344433-41344455 GGTTAGGGCAGAGGGGTGAGGGG - Intronic
1184039268 22:41933562-41933584 GGGCAGCTCCCTGGGGAGAGTGG - Intergenic
1184046565 22:41976178-41976200 GGTGGGCACCCTGGGGAGAGGGG - Intergenic
1184620198 22:45671513-45671535 GGTAAGGGGCCTGTGGAGGGTGG - Intergenic
1184658671 22:45955271-45955293 GGCGAGGGGGCTGGGGAGAGGGG + Intronic
1184847477 22:47098266-47098288 GGGTAGGACTCTGGGGACAGGGG - Intronic
1203285798 22_KI270734v1_random:153847-153869 GGTTGGGGAGCTGGGGAGGGGGG - Intergenic
950159964 3:10753033-10753055 TGTCAGAGCACTGGGGAGAGAGG - Intergenic
950577662 3:13842419-13842441 GGATAGGACCCTGGGGCAAGGGG + Intronic
950712916 3:14826320-14826342 GATGAGGGCAGTGGGGAGAGGGG - Intronic
951072965 3:18353401-18353423 GGTAAGGGCCCTGGGAAGAAAGG - Intronic
952511800 3:34065730-34065752 GGTTAGGGCCATGGGTAGTTTGG + Intergenic
952827824 3:37538594-37538616 GGTCAGGGCCCTGGGAAGGTGGG - Intronic
953575782 3:44112171-44112193 TGTGAGGGCACTGGGGTGAGAGG + Intergenic
954111880 3:48438370-48438392 GCCTAGAACCCTGGGGAGAGAGG - Intronic
954133899 3:48573274-48573296 GGTTAGGGTCATAGGGAGATGGG - Intronic
954134414 3:48575445-48575467 GGTCTGGCCCTTGGGGAGAGGGG - Exonic
954298222 3:49685820-49685842 GGTTAGGGCCCTGGCGGGGCCGG + Intronic
954440017 3:50516665-50516687 GCAGAGGGCCCTGCGGAGAGTGG - Intergenic
954904097 3:54044882-54044904 GTTTAGGGCCCGTGGGAGGGTGG + Intergenic
955390987 3:58522092-58522114 GGTCAGTGCCCAGGGCAGAGTGG + Intronic
955820324 3:62889685-62889707 TGTGAGGGTCCTGGGGATAGTGG - Intergenic
957803278 3:85114205-85114227 GGATGGGGGACTGGGGAGAGGGG + Intronic
959391040 3:105773935-105773957 GGCTTGGGCCCTGAGCAGAGAGG + Intronic
959537753 3:107506139-107506161 GGATAGGGACCGGGGGAGAAGGG - Intergenic
961314225 3:126023464-126023486 AGTTAGGGCACAGGGGAGGGGGG + Intronic
961492037 3:127263121-127263143 GGGTGGGGCCCTGAGGTGAGAGG - Intergenic
961677682 3:128577663-128577685 GGGCAGGGGCCTGGGCAGAGAGG - Intergenic
961815310 3:129547263-129547285 GGTCAGTGTCTTGGGGAGAGGGG + Intronic
963608322 3:147433486-147433508 GGTAAAGGCCCTGGGGTGGGGGG + Intronic
965802964 3:172513294-172513316 GGATAGGGGCTTGGGGAGGGTGG - Intronic
966940901 3:184746411-184746433 GTTTTGGCACCTGGGGAGAGGGG + Intergenic
967076590 3:186008847-186008869 GGTGAGGCCCCAGGGGAGAGAGG - Intergenic
968173945 3:196532908-196532930 GGTTAGGAGGCTGGGGAGATGGG + Intergenic
968247572 3:197168224-197168246 GGTCAGTGCCCTGTAGAGAGGGG - Intronic
968701672 4:2060561-2060583 TGCTGGGGCCCTGGGAAGAGGGG + Intronic
968957485 4:3726716-3726738 GGTTAGGGCTCAGGGCAGTGGGG - Intergenic
968970227 4:3789823-3789845 GGTCTGGGCCCTGAGGAGTGGGG - Intergenic
969032808 4:4227407-4227429 GGTTGCGGGACTGGGGAGAGGGG + Intergenic
969501494 4:7556197-7556219 GGTTTTGGCAATGGGGAGAGTGG + Intronic
972797712 4:42438636-42438658 GTTCAGGGCCCTGGGAAAAGCGG + Intronic
975448743 4:74500150-74500172 GGTTTGGGCCCTGGAGAGCAAGG + Intergenic
976077801 4:81319539-81319561 GGCTAAGGCCCTGGGCAGAGGGG - Intergenic
978164650 4:105592285-105592307 GGTTATGACCCTGGCGTGAGTGG - Intronic
979523812 4:121697039-121697061 GGTTGGGGCCCTGGCGGGGGTGG - Exonic
979859326 4:125674698-125674720 GGTTAGGTCGCTGAGGAGAGGGG - Intergenic
981658940 4:147144069-147144091 GGTGAGGGCTGTGGGAAGAGTGG + Intergenic
982436260 4:155385109-155385131 GGTCTAGGCCCTGGGAAGAGAGG - Intergenic
982823934 4:159978441-159978463 GGGTAGGGCCCTGGGTAGTATGG - Intergenic
984200288 4:176711610-176711632 GGTTTGGGGCCTTGAGAGAGAGG + Exonic
984761222 4:183364515-183364537 GGGTAGTCCCCTGGGGACAGTGG + Intergenic
985670203 5:1203034-1203056 GGATAGGGCCCTGGGGGAGGGGG - Intronic
985704425 5:1392264-1392286 GGTGAGGGGCTGGGGGAGAGCGG + Intergenic
986719805 5:10552906-10552928 GGTAAGGTGCCTGGGGAGGGAGG + Intergenic
986977546 5:13410706-13410728 GGATTGGGCCCTGGGGAGCTGGG - Intergenic
990602110 5:57369420-57369442 GGGGAGGTCCCTGGAGAGAGAGG - Intergenic
992201632 5:74390121-74390143 TGTTTGGGTCCTAGGGAGAGAGG - Intergenic
992643931 5:78794732-78794754 GGTGAGGCCACTGGGGTGAGAGG + Intronic
992781093 5:80128578-80128600 GGAAAGGGAACTGGGGAGAGAGG + Intronic
992897047 5:81254546-81254568 GGGAAGGCCCCTGGAGAGAGGGG + Intronic
997470512 5:134114728-134114750 GGCTAGGGCGCGGGGCAGAGCGG - Exonic
998583813 5:143405039-143405061 GGAGAGGGCCGTGGGGCGAGGGG + Intronic
999247704 5:150163969-150163991 AGTCAAGGCCCTGGGGAGTGGGG - Intergenic
999478675 5:151925052-151925074 GGTTAGGGGCGAGGGGAAAGCGG + Intergenic
999773283 5:154791494-154791516 GGCTAGGGGGCTGGGGACAGTGG - Intronic
1000329601 5:160196393-160196415 TGATGGGGCTCTGGGGAGAGAGG + Intronic
1001170795 5:169417251-169417273 GGTAACTGTCCTGGGGAGAGAGG - Intergenic
1002305639 5:178281012-178281034 ACTTAGGGCCCTGGGGAGAACGG + Intronic
1002532883 5:179859093-179859115 GGTTCCGGCCCTGGGGAGACTGG + Exonic
1003672779 6:8174807-8174829 GGGCAGGGCCCTGGAGGGAGCGG + Intergenic
1004701941 6:18087610-18087632 GGGTTGGGTCCTGGGAAGAGGGG - Intergenic
1005473282 6:26182903-26182925 GGCTAGGGGGCTGGGGAGCGTGG + Intergenic
1005743497 6:28814539-28814561 GGCTGGGGCACTGGGGAGAACGG + Intergenic
1005841198 6:29745582-29745604 GGGCAGGGCCCCGGGGACAGTGG - Intergenic
1005997329 6:30939438-30939460 GCTTGGGTCCCTGGGGAAAGGGG + Intergenic
1006053514 6:31362804-31362826 GGTCAGGACACTGGGTAGAGTGG - Intergenic
1006293337 6:33157780-33157802 GATTGGGGCCCTGGGGAGAGAGG - Intergenic
1006453897 6:34121384-34121406 TGTCAGGGCCCTGGAGAGGGTGG - Intronic
1006752409 6:36387046-36387068 GGTATGGGTCCTGGCGAGAGGGG + Intronic
1006794465 6:36722733-36722755 GGTAAGGGCATTGGGGAGGGCGG + Exonic
1007726413 6:43918635-43918657 GGTGAGGGGCCTGAGGAGTGTGG + Intergenic
1007764900 6:44154584-44154606 GGGCAGGGCCCTGGGGGGCGGGG - Intronic
1008138001 6:47799645-47799667 GGCTGGGGCCCTGGGAAGTGAGG + Intronic
1009949676 6:70381060-70381082 GGGTAGGGCCTTGGGAAGTGGGG - Intergenic
1011624340 6:89271147-89271169 GGCTGGGGCCCTGGGGTGGGGGG + Intronic
1013628145 6:111957985-111958007 GTTCAGGGCCCTGGGGATAAGGG + Intergenic
1014797996 6:125748173-125748195 GGGTTTGGCCCGGGGGAGAGCGG - Intronic
1015870777 6:137774333-137774355 AGTTTGGGTCCTAGGGAGAGGGG - Intergenic
1016799779 6:148156842-148156864 GGTCAGGCCCCTGGGGCTAGTGG + Intergenic
1016985438 6:149891348-149891370 GGTTAGGGACAGTGGGAGAGGGG - Intronic
1017645306 6:156534639-156534661 GGTGAGGTACCTGGGGAGATTGG - Intergenic
1018834194 6:167470996-167471018 ACTGAGGGCCCTTGGGAGAGAGG + Intergenic
1018860976 6:167710292-167710314 AGTGAAGGCCCTGGGGAGACGGG + Intergenic
1019048887 6:169168230-169168252 GTTTAGGGCCCTGGGGGGACAGG - Intergenic
1019273611 7:164407-164429 ACTCAGAGCCCTGGGGAGAGAGG - Intergenic
1019412164 7:911437-911459 GGTTTGGGGCTTGGGGAGGGGGG - Intronic
1019477099 7:1249397-1249419 GGTCAGGGCCGTGGAGAGCGTGG - Intergenic
1019512067 7:1422650-1422672 GGGTGGGGCCCTGGGGACACCGG - Intergenic
1019714609 7:2532809-2532831 GGCCAGGGCCCTAGAGAGAGGGG - Intergenic
1019741710 7:2678244-2678266 GGCCAGGGCCCTAGAGAGAGGGG + Intergenic
1021746382 7:23745268-23745290 GGTTATGGAGCTGGGTAGAGTGG + Intronic
1022544447 7:31173205-31173227 AGTTTAGGCCCTGGTGAGAGGGG + Intergenic
1023675457 7:42624623-42624645 GGTCAGGTCCCTTTGGAGAGTGG + Intergenic
1023764308 7:43496588-43496610 GGGTGGGGTCCTGAGGAGAGTGG - Intronic
1023873323 7:44274279-44274301 GCTTCTGGCCCTGGGGACAGAGG + Intronic
1024195962 7:47059276-47059298 GTTTAGGGACCTGGGGAAGGAGG - Intergenic
1025697904 7:63789656-63789678 GGCTTGGGGCCCGGGGAGAGAGG - Intergenic
1026911621 7:74094671-74094693 GGTTAGAGCCCTGGGACGGGAGG + Intronic
1028984034 7:96996149-96996171 GGTTAGCTCCCAGGAGAGAGAGG - Intergenic
1029458912 7:100684463-100684485 GGTGAGGGCCCTGGGGCAAAGGG + Exonic
1029622811 7:101700451-101700473 GGTGGGGGGCCTGGGGAGAAGGG + Intergenic
1029667882 7:102007587-102007609 GTTTAGGGCCCAGGTGAGGGTGG - Intronic
1029697155 7:102221052-102221074 GGTTAGGGGAGAGGGGAGAGGGG - Intronic
1032403802 7:131641602-131641624 GTTTTAGGCACTGGGGAGAGCGG - Intergenic
1032537675 7:132678224-132678246 GGCCAGGGCCCTGGGGATACTGG + Intronic
1033591502 7:142812524-142812546 GGTTAGGGCTCAGGAGAGGGTGG + Intergenic
1034700042 7:153087864-153087886 GGTGAGGGTCTTGGGGTGAGTGG + Intergenic
1034995099 7:155572035-155572057 GGAGAGGGGCATGGGGAGAGAGG + Intergenic
1035009156 7:155697138-155697160 GGATGGGGTTCTGGGGAGAGGGG + Intronic
1035608793 8:947297-947319 GGTTTGGGCCCTGGGGACGGGGG + Intergenic
1035713655 8:1737693-1737715 GGATAGGGCACTGGGGGCAGAGG - Intergenic
1037731604 8:21529799-21529821 GGGTGGGGCTGTGGGGAGAGTGG - Intergenic
1037937810 8:22927208-22927230 TGTTGGGGTTCTGGGGAGAGGGG + Intronic
1039844327 8:41315366-41315388 GGTGCAAGCCCTGGGGAGAGAGG - Intergenic
1040646345 8:49401657-49401679 AATGAGGACCCTGGGGAGAGCGG + Intergenic
1044451096 8:92336297-92336319 GGATGGAGCCCTGTGGAGAGGGG - Intergenic
1049298603 8:141856891-141856913 AATGAGGGCCCTGGGGAGAAAGG + Intergenic
1049419102 8:142509113-142509135 GATTCGGGCCCAGGGGAGAAGGG - Intronic
1049423546 8:142527207-142527229 GGACAGGGCCCTGGGCACAGAGG + Intronic
1049483954 8:142841743-142841765 GGTTAGGGCCCTGGGGAGAGAGG - Intronic
1049661160 8:143820271-143820293 GGTCAGGCCCCTGAGGAGAGAGG - Intronic
1049703461 8:144025172-144025194 GGAGAGGGCCCTGAGGAGAAAGG - Intronic
1050120163 9:2299712-2299734 GGTAAGGGCAAGGGGGAGAGAGG + Intergenic
1050786696 9:9412556-9412578 GATGAGGGCCTTGAGGAGAGTGG - Intronic
1050820388 9:9871818-9871840 GGAAAGGGGCCTGGGGGGAGGGG + Intronic
1050952877 9:11618927-11618949 GGTTCGGGCCCAGGGTAGGGTGG - Intergenic
1053209924 9:36219078-36219100 TGTGAGGGCCCAGGGGAGACAGG - Intronic
1058960571 9:109989220-109989242 GGGAGGGGCCCTTGGGAGAGGGG - Intronic
1060732332 9:126046666-126046688 GGAGGGGGCCCAGGGGAGAGAGG - Intergenic
1061059334 9:128242891-128242913 GCTAAGCGCCCTGGGGAGGGTGG + Intronic
1061178776 9:129012177-129012199 GGTGTGGGACGTGGGGAGAGAGG + Intronic
1061818304 9:133208859-133208881 GGGTTGGGCCCTGTGGAGGGAGG - Intronic
1061912864 9:133734113-133734135 GGGTAGGGCTCTGGCGAGGGTGG + Exonic
1062205173 9:135332506-135332528 GGTTTGGGCATTTGGGAGAGGGG + Intergenic
1062242148 9:135546499-135546521 GGGTTGGGCCCTGTGGAGGGAGG + Intronic
1062338307 9:136082200-136082222 GGTGAAGACCCTGGGGAGACGGG - Intronic
1062340073 9:136090225-136090247 GGTGGGGGCCCTGGCCAGAGGGG + Intronic
1062620048 9:137416589-137416611 TGTTAGGGTCCTGGGTGGAGAGG - Intronic
1185765138 X:2719264-2719286 TGTTAGGGACCTGGGAGGAGAGG + Intronic
1189303362 X:39969084-39969106 CTTTAGGGCCCTGGTGGGAGTGG + Intergenic
1189564003 X:42220567-42220589 GGTCAGGGCACTGGGAAAAGAGG - Intergenic
1190255934 X:48762153-48762175 GATTAAGGCCATGTGGAGAGAGG + Intronic
1192359436 X:70429788-70429810 GGGCAGGGCCCTGGGGGTAGGGG - Intronic
1192564683 X:72153878-72153900 TGTCAGGGGCCTGGGGAGACAGG - Intergenic
1195221954 X:102753125-102753147 GGTTAGGGGCACAGGGAGAGAGG - Exonic
1196862764 X:120043169-120043191 GGTCAGGGCACTGGGGTGGGAGG - Intergenic
1196880338 X:120193175-120193197 GGTCAGGGCACTGGGGTGGGAGG + Intergenic
1197106309 X:122720697-122720719 AGTTAGGGAGATGGGGAGAGAGG + Intergenic
1199622924 X:149715213-149715235 GGTGAGGGCCCTGAGCACAGAGG + Intronic
1202366855 Y:24171597-24171619 GGAGAGGGCCCTGGAGAGAGGGG - Intergenic
1202373809 Y:24215426-24215448 GGCCAGGGTCCTGGGGACAGGGG - Intergenic
1202496972 Y:25454694-25454716 GGCCAGGGTCCTGGGGACAGGGG + Intergenic
1202503927 Y:25498526-25498548 GGAGAGGGCCCTGGAGAGAGGGG + Intergenic