ID: 1049483960

View in Genome Browser
Species Human (GRCh38)
Location 8:142841759-142841781
Sequence CCTAACCTGCAGAAGATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049483953_1049483960 -6 Left 1049483953 8:142841742-142841764 CCCTCTCTCCCCAGGGCCCTAAC 0: 1
1: 0
2: 5
3: 30
4: 366
Right 1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG No data
1049483950_1049483960 3 Left 1049483950 8:142841733-142841755 CCTCTGGTGCCCTCTCTCCCCAG 0: 1
1: 1
2: 4
3: 66
4: 589
Right 1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG No data
1049483954_1049483960 -7 Left 1049483954 8:142841743-142841765 CCTCTCTCCCCAGGGCCCTAACC 0: 1
1: 0
2: 5
3: 61
4: 454
Right 1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG No data
1049483948_1049483960 12 Left 1049483948 8:142841724-142841746 CCTCAGAGCCCTCTGGTGCCCTC 0: 1
1: 0
2: 2
3: 49
4: 659
Right 1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG No data
1049483949_1049483960 4 Left 1049483949 8:142841732-142841754 CCCTCTGGTGCCCTCTCTCCCCA 0: 1
1: 0
2: 7
3: 61
4: 533
Right 1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049483960 Original CRISPR CCTAACCTGCAGAAGATGTA TGG Intronic
No off target data available for this crispr