ID: 1049486828

View in Genome Browser
Species Human (GRCh38)
Location 8:142869510-142869532
Sequence CTGCTTATACAGATCAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049486824_1049486828 1 Left 1049486824 8:142869486-142869508 CCGTCCACTTGACCTAGAACTCC 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1049486828 8:142869510-142869532 CTGCTTATACAGATCAAATAAGG No data
1049486825_1049486828 -3 Left 1049486825 8:142869490-142869512 CCACTTGACCTAGAACTCCTCTG 0: 1
1: 0
2: 3
3: 22
4: 274
Right 1049486828 8:142869510-142869532 CTGCTTATACAGATCAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049486828 Original CRISPR CTGCTTATACAGATCAAATA AGG Intronic
No off target data available for this crispr