ID: 1049487231

View in Genome Browser
Species Human (GRCh38)
Location 8:142872749-142872771
Sequence CAGCCTATGAATTCTGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 245}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049487231_1049487241 26 Left 1049487231 8:142872749-142872771 CCGCCTCCAGAATTCATAGGCTG 0: 1
1: 0
2: 5
3: 31
4: 245
Right 1049487241 8:142872798-142872820 TAGCAGGGCCGGGCCTTTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 89
1049487231_1049487244 29 Left 1049487231 8:142872749-142872771 CCGCCTCCAGAATTCATAGGCTG 0: 1
1: 0
2: 5
3: 31
4: 245
Right 1049487244 8:142872801-142872823 CAGGGCCGGGCCTTTGAGGGGGG 0: 1
1: 0
2: 0
3: 31
4: 246
1049487231_1049487234 -6 Left 1049487231 8:142872749-142872771 CCGCCTCCAGAATTCATAGGCTG 0: 1
1: 0
2: 5
3: 31
4: 245
Right 1049487234 8:142872766-142872788 AGGCTGAAATCTAGTCACCAAGG 0: 1
1: 0
2: 2
3: 21
4: 203
1049487231_1049487238 15 Left 1049487231 8:142872749-142872771 CCGCCTCCAGAATTCATAGGCTG 0: 1
1: 0
2: 5
3: 31
4: 245
Right 1049487238 8:142872787-142872809 GGTGACGATAATAGCAGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 74
1049487231_1049487235 10 Left 1049487231 8:142872749-142872771 CCGCCTCCAGAATTCATAGGCTG 0: 1
1: 0
2: 5
3: 31
4: 245
Right 1049487235 8:142872782-142872804 ACCAAGGTGACGATAATAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 169
1049487231_1049487243 28 Left 1049487231 8:142872749-142872771 CCGCCTCCAGAATTCATAGGCTG 0: 1
1: 0
2: 5
3: 31
4: 245
Right 1049487243 8:142872800-142872822 GCAGGGCCGGGCCTTTGAGGGGG 0: 1
1: 0
2: 0
3: 21
4: 262
1049487231_1049487237 11 Left 1049487231 8:142872749-142872771 CCGCCTCCAGAATTCATAGGCTG 0: 1
1: 0
2: 5
3: 31
4: 245
Right 1049487237 8:142872783-142872805 CCAAGGTGACGATAATAGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 98
1049487231_1049487240 25 Left 1049487231 8:142872749-142872771 CCGCCTCCAGAATTCATAGGCTG 0: 1
1: 0
2: 5
3: 31
4: 245
Right 1049487240 8:142872797-142872819 ATAGCAGGGCCGGGCCTTTGAGG 0: 1
1: 0
2: 0
3: 13
4: 103
1049487231_1049487239 16 Left 1049487231 8:142872749-142872771 CCGCCTCCAGAATTCATAGGCTG 0: 1
1: 0
2: 5
3: 31
4: 245
Right 1049487239 8:142872788-142872810 GTGACGATAATAGCAGGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 82
1049487231_1049487242 27 Left 1049487231 8:142872749-142872771 CCGCCTCCAGAATTCATAGGCTG 0: 1
1: 0
2: 5
3: 31
4: 245
Right 1049487242 8:142872799-142872821 AGCAGGGCCGGGCCTTTGAGGGG 0: 1
1: 0
2: 0
3: 24
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049487231 Original CRISPR CAGCCTATGAATTCTGGAGG CGG (reversed) Intronic
900518245 1:3093433-3093455 CAGTCAATCAATTCTGGAAGAGG - Intronic
902390221 1:16099530-16099552 CACCCTATGAATTTGGCAGGGGG - Intergenic
904941802 1:34168875-34168897 CAACCTATGAATTTGGGTGGGGG + Intronic
905539880 1:38751994-38752016 CAGCCTATGCATGCTGGAAGTGG - Intergenic
906330937 1:44883645-44883667 TAGCCTCAGAATTCTGGGGGAGG + Intronic
906977176 1:50588464-50588486 CAGCCCATAAAGTCTGGAAGAGG - Intronic
907626874 1:56039134-56039156 CATTCTGTGAATGCTGGAGGGGG - Intergenic
907935715 1:59040455-59040477 CAACCTATGAATTTTTGGGGTGG + Intergenic
908176378 1:61559170-61559192 CAACATATAAATTTTGGAGGGGG + Intergenic
908502824 1:64761328-64761350 CAGACAATGAATTTTGGGGGGGG - Intronic
909535749 1:76734148-76734170 CAACATATGAATTATGGATGGGG + Intergenic
910063635 1:83124661-83124683 CAACATATGAATTTAGGAGGTGG + Intergenic
917287796 1:173439822-173439844 AAGCCTCTGAATTTTGGAGGAGG - Intergenic
918359006 1:183735897-183735919 CAGCCTCCTAATTGTGGAGGGGG - Intronic
920196793 1:204233285-204233307 CAGCCTAAGCCTCCTGGAGGAGG + Intronic
920220793 1:204398832-204398854 CAGCCTATTAATTCTGGGAAAGG + Intergenic
921968628 1:221120287-221120309 CAACATATGAATTTTGGAGAGGG + Intergenic
923464127 1:234232943-234232965 CAGAGCACGAATTCTGGAGGAGG + Intronic
924848092 1:247793406-247793428 AAGACTATGTCTTCTGGAGGAGG - Intergenic
924948660 1:248863346-248863368 CACCCTATCAACTCAGGAGGGGG - Intergenic
1063687055 10:8246963-8246985 CAACATATGAATTCTTAAGGAGG + Intergenic
1065228804 10:23575396-23575418 CAACATGTGAATTTTGGAGGGGG - Intergenic
1067363433 10:45602462-45602484 CAACATATGAATTTTGGGGGTGG - Intergenic
1067368234 10:45656685-45656707 CAGCATATGAATTTGGGTGGGGG - Intronic
1067790197 10:49281939-49281961 CATCCAATGTATCCTGGAGGTGG - Intergenic
1067822287 10:49540659-49540681 CAGCATATGAATTTTGGGGAGGG - Intergenic
1067982379 10:51101096-51101118 CAACCTATGAATTCTCGTGTGGG - Intronic
1068378571 10:56216559-56216581 CTGCCTATGAATTGTGTATGTGG - Intergenic
1070798587 10:79231539-79231561 CAGCCTAGGAAGCCTGGTGGGGG + Intronic
1072560942 10:96573475-96573497 CAGCATATCCATGCTGGAGGTGG + Intronic
1073329690 10:102661907-102661929 CAGCCTGTAAATTCTGGGGGAGG + Intergenic
1074276011 10:112002686-112002708 TAGCCTCTGAATTCTTGGGGAGG + Intergenic
1074604481 10:114947157-114947179 CAGCCTCTAAAAGCTGGAGGAGG + Intronic
1076199633 10:128547619-128547641 CAGCCCAGGGGTTCTGGAGGGGG + Intergenic
1077333355 11:1993002-1993024 CAGCCCCTGAGTGCTGGAGGGGG - Intergenic
1078682695 11:13493858-13493880 CAGCATGTTAATTCTGGGGGAGG - Intronic
1079109264 11:17595162-17595184 CAGCCTCTGAAATCCTGAGGTGG + Intronic
1079459226 11:20665469-20665491 CAGACTATGACTGCTGAAGGTGG + Intergenic
1079551957 11:21710804-21710826 CAGCATATGAATTTTGGTGAGGG + Intergenic
1080010066 11:27449734-27449756 CGTCCTTTGAATTCTGGAAGTGG - Intronic
1082707035 11:56505170-56505192 CAGCATATGAATTTTGGAGAGGG - Intergenic
1082959093 11:58901996-58902018 GAGCCTCTGGAGTCTGGAGGTGG + Intronic
1082974621 11:59059579-59059601 GAGCCTCTGGAATCTGGAGGGGG + Intergenic
1085958457 11:81429994-81430016 CAGGCTATGAATTCCTGAGCTGG + Intergenic
1088220408 11:107564941-107564963 CAAACTCAGAATTCTGGAGGAGG - Intronic
1088947789 11:114532511-114532533 CAGCCTGTGACTTGTGGAGGTGG - Intronic
1090388068 11:126368058-126368080 AATCCTTTGAATTCAGGAGGTGG + Intronic
1090651916 11:128814390-128814412 CAGCATATGAATTTGGGAGAAGG + Intergenic
1090971781 11:131650056-131650078 CTGCCTCTGGTTTCTGGAGGAGG + Intronic
1091333360 11:134748622-134748644 TAGCCTCTGAGTTCTGGAGGAGG - Intergenic
1202816333 11_KI270721v1_random:48183-48205 CAGCCCCTGAGTGCTGGAGGGGG - Intergenic
1093143950 12:15542056-15542078 CAGCATATGAATTTAGGCGGAGG + Intronic
1093199962 12:16174647-16174669 CAGCCTATAAATTTGAGAGGGGG + Intergenic
1093811584 12:23498760-23498782 CAGCCTCTGAATTTTTTAGGAGG + Intergenic
1094412730 12:30184381-30184403 CAGCATACGAATTTTGGAGAGGG + Intergenic
1094818212 12:34206205-34206227 CAGCCCATGCATTCTGGAGGAGG - Intergenic
1095098709 12:38161070-38161092 CAGCCCATGGGTTCTGGAGGGGG + Intergenic
1096454943 12:51777084-51777106 AAGCCTGTCAGTTCTGGAGGTGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096833454 12:54332434-54332456 CAGCCATTGAAAGCTGGAGGTGG + Intronic
1096896130 12:54821937-54821959 CAGCCTAAGGATCCTGGAGGTGG - Intergenic
1100476518 12:94940426-94940448 CAACATATGAATTCTGGGTGGGG - Intronic
1102721292 12:115018566-115018588 CAACATAGGAATTTTGGAGGGGG + Intergenic
1102734862 12:115150387-115150409 CAACGTATGAATTCTGGAGGTGG + Intergenic
1104119939 12:125789518-125789540 CAACTTATGAATTAGGGAGGGGG - Intergenic
1104558630 12:129824443-129824465 CAACATAGGAATTCTGGGGGCGG - Intronic
1104916906 12:132270327-132270349 CGGCCTTTGCCTTCTGGAGGAGG - Intronic
1109522919 13:63535285-63535307 GAGCCTCTGAGTGCTGGAGGAGG - Intergenic
1109791445 13:67253760-67253782 CAGCCTATGAACTCTGGGAGGGG - Intergenic
1111191986 13:84820538-84820560 CAGTCCATAAAGTCTGGAGGAGG + Intergenic
1111231286 13:85347157-85347179 CAACCTATGAATTTTGGTTGGGG - Intergenic
1111821669 13:93223528-93223550 AATCCTTTGAACTCTGGAGGTGG - Intergenic
1114520483 14:23331374-23331396 CAGCATATGGATTGTGGTGGAGG - Intergenic
1116125199 14:40775033-40775055 CAACATATAAATTTTGGAGGGGG + Intergenic
1116734417 14:48671035-48671057 CAGCCTCTGCTTCCTGGAGGTGG - Intergenic
1116769491 14:49110750-49110772 CAGGGTTTGAATTCTGGAGTAGG + Intergenic
1117103946 14:52379924-52379946 CAACATATGAATTCTGAGGGAGG + Intergenic
1117481411 14:56148933-56148955 CAGCCCATGAATATCGGAGGAGG + Intronic
1117738124 14:58788172-58788194 AAGCCTCTGAATTCTCAAGGTGG - Intergenic
1118817499 14:69323592-69323614 GGGCCTATGAATTGTGGGGGAGG - Intronic
1118869676 14:69730766-69730788 ATGCCTATAAATTTTGGAGGAGG - Intronic
1120862384 14:89266463-89266485 CAACATATAAATTTTGGAGGCGG + Intronic
1121454492 14:94029669-94029691 CAACATATGAATTTTGGTGGGGG + Intronic
1123768033 15:23501074-23501096 CAACATATGAATTTTGGAGGAGG - Intergenic
1124023061 15:25941317-25941339 CAACATATGAATTTTGCAGGAGG + Intergenic
1124570256 15:30856493-30856515 CAACATATGAATTTTGGAGGAGG + Intergenic
1126516015 15:49539056-49539078 CAGCATGTAAATTCTGGAAGAGG - Intronic
1126824385 15:52534613-52534635 CAGCATATGAATTTTGGATGGGG - Intergenic
1127011642 15:54636915-54636937 CAGCCTATAAAGTCTGAAAGAGG + Intergenic
1127826614 15:62709335-62709357 CAGGCTCTAAATTATGGAGGTGG + Intronic
1127829735 15:62739779-62739801 AAGACTATGAATTCTGCTGGAGG - Intronic
1130926301 15:88388229-88388251 CAGCCAAGGAAGACTGGAGGGGG + Intergenic
1132272303 15:100537152-100537174 CAGCCTGTGAATTCTCTAGTGGG + Intronic
1132743669 16:1428073-1428095 GAGCCTCTGGATGCTGGAGGGGG - Intergenic
1133206697 16:4238359-4238381 CAGCCTATGGACTCAGGAGGGGG - Intronic
1133594533 16:7278818-7278840 CTGCCAATGAATTATGGAGCTGG + Intronic
1134250767 16:12572356-12572378 CAGGCTCTGCCTTCTGGAGGCGG + Exonic
1135638643 16:24100806-24100828 TAGTCTTTGAATTTTGGAGGAGG - Intronic
1136020134 16:27434837-27434859 CAGCCAGTGAATGCTGGAGCTGG + Intronic
1136842793 16:33552994-33553016 AATCGTATGAATTCGGGAGGTGG + Intergenic
1137909429 16:52361359-52361381 CAACATATGAATTTGGGAGGTGG - Intergenic
1138461780 16:57153161-57153183 CATCCCTTGGATTCTGGAGGAGG - Exonic
1139762370 16:69195878-69195900 CAGACTATAAAATCTGGAGTGGG + Intronic
1139820991 16:69721238-69721260 CAGCACCTGAATTTTGGAGGGGG - Intronic
1203152958 16_KI270728v1_random:1853292-1853314 AATCGTATGAATTCGGGAGGTGG + Intergenic
1144761671 17:17710777-17710799 AAGCCTGTGCATTCTGTAGGTGG + Intronic
1144803122 17:17944911-17944933 CGGCCTATGAAAAATGGAGGAGG - Intronic
1148974934 17:51519208-51519230 TAGCCTGTGAATGCAGGAGGGGG + Intergenic
1150769907 17:68032204-68032226 CAACATATGAATTTTTGAGGGGG - Intergenic
1153149357 18:2073171-2073193 CACACTAGGAATTCTGGAGAAGG + Intergenic
1153886145 18:9468554-9468576 TAGACTCTGAATTTTGGAGGGGG - Intergenic
1154296995 18:13160378-13160400 CAGTCTATGCGTTCTGGCGGTGG + Intergenic
1155072241 18:22326809-22326831 AAGCCAAGGAATTCTGAAGGTGG + Intergenic
1155628734 18:27865956-27865978 AAGCCTATGAATGCTGAAGATGG + Intergenic
1156113555 18:33758370-33758392 CAGCTTATGAATTTGGTAGGGGG - Intergenic
1156578647 18:38349712-38349734 CAGGCTTTGAGTTCTAGAGGAGG - Intergenic
1157038747 18:44011350-44011372 CGGCCTAAGAAATTTGGAGGTGG - Intergenic
1157439318 18:47697844-47697866 CAGCCTGAGAATTGTTGAGGAGG - Intergenic
1157887102 18:51379403-51379425 CAACATGTGAATTCTGGAGGAGG - Intergenic
1159178892 18:64874991-64875013 CAGTCTATAAATACTGGAAGAGG + Intergenic
1159243250 18:65771183-65771205 CAGTTTATGAATTCTGAAAGGGG + Intronic
1165267444 19:34672954-34672976 CAGCATATGAATTCTGTGGCGGG + Intronic
1166193202 19:41189580-41189602 CAGTGAATGAATTGTGGAGGAGG + Intergenic
925880667 2:8349760-8349782 CAGCACCTGAATTTTGGAGGAGG + Intergenic
926628000 2:15109818-15109840 CAACATATGAATTGTGGATGGGG + Intergenic
927466073 2:23337668-23337690 CAACATCTGAATTTTGGAGGGGG - Intergenic
930161059 2:48156327-48156349 CAGCACATGAATGCTGGTGGTGG - Intergenic
931778220 2:65557779-65557801 CAACATATGAATTTTGGGGGAGG + Intergenic
932403351 2:71497248-71497270 TAGCCTCTGAATTTTCGAGGAGG - Intronic
932437169 2:71708987-71709009 CAGCATATAAATTCTGGTGGTGG + Intergenic
932836098 2:75039029-75039051 CAGCCCATGAATTTCGGAGGTGG + Intergenic
933349383 2:81134724-81134746 TAGCCTATGAATATTGTAGGTGG + Intergenic
935042321 2:99444512-99444534 AAGCCTAAGAATTCTGTGGGTGG - Intronic
935788460 2:106570127-106570149 CAACATATGAATTTTGGGGGGGG - Intergenic
936167911 2:110139937-110139959 GAGCCTGTGCATCCTGGAGGTGG - Intronic
936792924 2:116171139-116171161 CAGCATATGGAAACTGGAGGTGG - Intergenic
937387951 2:121454156-121454178 CAGCATATTAATTTTGGAGGGGG - Intronic
939224639 2:139349373-139349395 CAGTCAATGAATTCAGGAGCTGG - Intergenic
943114292 2:183647001-183647023 CATGCTATGGATTCTGGAGGTGG - Intergenic
943856654 2:192802407-192802429 CATCATATGAATTTTGGGGGTGG + Intergenic
944441639 2:199749233-199749255 CAGCCTAGGAGTTCCTGAGGGGG + Intergenic
946381896 2:219354591-219354613 CAGACTCTGAATTAAGGAGGTGG - Intergenic
946533740 2:220604628-220604650 CAACATATGAATTTTGGAAGGGG + Intergenic
946851648 2:223912849-223912871 TAGCCTGTGATTTCTGGAAGAGG - Intronic
947032778 2:225816922-225816944 TAGCCTCTGAATTTTTGAGGAGG + Intergenic
947327327 2:228992668-228992690 CAGCACCTGAAGTCTGGAGGGGG + Intronic
947995412 2:234523283-234523305 CAGCATATGAATTTGGGTGGGGG - Intergenic
948261260 2:236606072-236606094 CAGCATATGAATTTTGGGGGTGG + Intergenic
1168730535 20:75079-75101 CAGCCTATAAAATCTGCAAGGGG + Intergenic
1169852745 20:10070361-10070383 CAGCCTAGGAAATATGGAGTAGG + Intergenic
1170153098 20:13245852-13245874 CAGCCTATAAATTGAGGAGCAGG - Intronic
1171169194 20:23000433-23000455 CAACATATCAATTCTGGGGGTGG + Intergenic
1172684602 20:36744592-36744614 GAGCCTTTGAAATGTGGAGGAGG + Intronic
1173060962 20:39660749-39660771 CAGCATATAAATTTTGGAAGGGG + Intergenic
1173435188 20:43026040-43026062 TAGCATATGAATTTTGGAGGGGG - Intronic
1176070592 20:63224317-63224339 CAGCCTGGGAATCCAGGAGGTGG - Intergenic
1176336629 21:5604873-5604895 CAGCTTCAGAATTCTGTAGGGGG + Intergenic
1176391128 21:6216075-6216097 CAGCTTCAGAATTCTGTAGGGGG - Intergenic
1176470291 21:7100099-7100121 CAGCTTCAGAATTCTGTAGGGGG + Intergenic
1176493852 21:7481877-7481899 CAGCTTCAGAATTCTGTAGGGGG + Intergenic
1176506790 21:7656506-7656528 CAGCTTCAGAATTCTGTAGGGGG - Intergenic
1176946799 21:14991919-14991941 CAGCTTTTTAATTCTGGATGAGG - Intronic
1179187414 21:39095687-39095709 TAGCATATGAATTCAGGATGCGG + Intergenic
1182926003 22:34126025-34126047 TAGCCTATGTATTGTGGAAGAGG - Intergenic
1183475713 22:38034711-38034733 CAGCCTGGGCTTTCTGGAGGGGG + Intronic
1183957751 22:41392180-41392202 CAACCTTAGAATTCTAGAGGTGG + Intronic
949291319 3:2469878-2469900 CTGCTTATGAATTTTGCAGGAGG + Intronic
949508424 3:4747615-4747637 CTGCCCATGAATTCTGGAGGAGG + Intronic
949636276 3:5984797-5984819 CAACATCTGAATTTTGGAGGTGG + Intergenic
954884251 3:53858046-53858068 CAGCGTATGAACTCTGGAGAGGG + Intronic
954991528 3:54844447-54844469 CAGCGTCTGCATTCTGGGGGAGG + Intronic
955127047 3:56123175-56123197 CAACATATGAATTTTGGGGGTGG - Intronic
957119143 3:76067108-76067130 CAGGCTGTGAATTCTGGAGTCGG + Intronic
957839199 3:85644407-85644429 CAGCATATGAATAGTGGTGGAGG + Intronic
957892860 3:86382453-86382475 TAGCCTCTGAATTCTTGGGGAGG - Intergenic
959349812 3:105248162-105248184 CAACATATAAATTTTGGAGGGGG - Intergenic
961792172 3:129384139-129384161 TGGCCTCTGAATTGTGGAGGGGG + Intergenic
965037410 3:163458733-163458755 CAACATATGAATTTGGGAGGAGG - Intergenic
966622410 3:181980268-181980290 CAGCATATGAATTTGGGAGCAGG - Intergenic
969379966 4:6788707-6788729 CAGTCTCTGATTTCAGGAGGAGG + Intronic
970714037 4:18899405-18899427 CAACCTATGAATTTTTGGGGGGG + Intergenic
971245351 4:24922193-24922215 CAGCATATGAATTTGGGAGGAGG + Intronic
971456466 4:26850098-26850120 CAACATATGAATTTGGGAGGGGG - Intergenic
971732762 4:30406927-30406949 CAGCCTAAGCATTCTGCTGGTGG + Intergenic
974724801 4:65784765-65784787 CAACATATGAACTTTGGAGGAGG + Intergenic
974815236 4:66995548-66995570 CAACATATGAATGATGGAGGAGG + Intergenic
976713796 4:88101563-88101585 CAACATATGAATTTTGGTGGGGG - Intronic
977133234 4:93268444-93268466 CAACATATGAATTTTTGAGGTGG + Intronic
978875580 4:113636827-113636849 CAACATATGAATTGGGGAGGTGG + Intronic
981284998 4:143006035-143006057 CAGCCCATGAAGTCTGGAAGTGG + Intergenic
981434340 4:144702639-144702661 CAGCCTATGAAGCTTGGATGAGG + Intronic
982780262 4:159482992-159483014 CAACCTGTGAATTTTGGGGGAGG + Intergenic
983666221 4:170187981-170188003 CAGTCTATAAAGTCTGGAGTAGG - Intergenic
985748273 5:1660063-1660085 CAGCGTGTGAATTCTGGGGCAGG + Intergenic
986716584 5:10528696-10528718 CAGCAGATGAATTTTGGGGGGGG - Intergenic
986762266 5:10891081-10891103 CAACATATGAATTTTGGAGGAGG - Intergenic
987243938 5:16029187-16029209 TGGCCCATGCATTCTGGAGGAGG - Intergenic
988622450 5:32836928-32836950 AAGCCTATGAATTCACAAGGAGG + Intergenic
989565482 5:42897281-42897303 AAGCCTAAGAATTCTGATGGTGG - Intergenic
991039957 5:62164901-62164923 CAACATATGAAATTTGGAGGGGG + Intergenic
992823167 5:80518886-80518908 GAGGCTATGAATTTTGGAGATGG - Intronic
994696958 5:103084578-103084600 CAGTCTATGAAGACTGGAAGAGG - Intergenic
995565416 5:113429127-113429149 CAGCATATGAATTTGGGAAGGGG - Intronic
998513072 5:142729737-142729759 CAACGTATGAATTTTGGGGGGGG + Intergenic
998834641 5:146191834-146191856 GAGACTGTGAATTCTGGAGTGGG + Intergenic
999339473 5:150757579-150757601 GATCCAATAAATTCTGGAGGTGG + Intronic
999831420 5:155323875-155323897 CAACGTATGAATTGGGGAGGGGG - Intergenic
1001055607 5:168447320-168447342 CAGCAGATGATTTCTGGAGAGGG + Intronic
1001615602 5:173041239-173041261 TAGCCTCTGAATTCTCGGGGAGG - Intergenic
1001805273 5:174579387-174579409 CAGCCTCTGAAAGCTGGAAGAGG + Intergenic
1003142195 6:3480939-3480961 CAGCATATGAATTTGGGAGGGGG + Intergenic
1003238115 6:4316867-4316889 CAGCCTCAGAAATCTGGAGACGG - Intergenic
1004254712 6:14052387-14052409 CAGCCTCTGAACTCTGGAAAGGG + Intergenic
1005815508 6:29548805-29548827 CAACATATGAATTTTGGGGGGGG + Intergenic
1006494891 6:34415464-34415486 CTGCCTATCAATACTGAAGGTGG + Intronic
1006649987 6:35543579-35543601 TAGCCGAGGAATTCTGGGGGCGG + Intergenic
1007226516 6:40319236-40319258 CTGCATATGAATTTTGGAAGGGG - Intergenic
1008262492 6:49384340-49384362 CATCATATGAATTTTGGCGGGGG - Intergenic
1008762422 6:54868649-54868671 CAGCATCTGAATTCTGGTGATGG - Intronic
1009420752 6:63461601-63461623 CAGCATATCTCTTCTGGAGGTGG - Intergenic
1010974473 6:82296897-82296919 CAGCATATGAATTTGGAAGGGGG + Intergenic
1011019730 6:82798962-82798984 CAGCATATAAATTTTGGAGTTGG - Intergenic
1011171643 6:84511266-84511288 CAACATATGAATTTGGGAGGTGG - Intergenic
1012469713 6:99557423-99557445 CAACATACGAATTTTGGAGGGGG - Intronic
1012968865 6:105705260-105705282 CAACATATAAATTTTGGAGGGGG + Intergenic
1013076597 6:106777094-106777116 CAACATATAAATTCTGGGGGAGG + Intergenic
1014553572 6:122817736-122817758 CAGCATATGAATTTTCAAGGGGG + Intergenic
1014642177 6:123926159-123926181 CAACATATGAATTTGGGAGGAGG + Intronic
1021300909 7:18972095-18972117 GAGCCTATGAACTCTTGAAGAGG - Intronic
1023839026 7:44085586-44085608 TAGCCTCTGAATTCTGGGGGAGG + Intergenic
1023989575 7:45120276-45120298 CAACATATGAATTTTGGAAGAGG + Intergenic
1024509017 7:50188264-50188286 CAACCCATGAATTTTGGTGGGGG - Intergenic
1031339695 7:120583770-120583792 CAGCATAGGAATTGTGGGGGGGG + Intronic
1031566777 7:123308610-123308632 CATCATTTGAAATCTGGAGGGGG + Intergenic
1033041167 7:137919467-137919489 CAGCCTATCATTTCTAGATGAGG + Intronic
1033363216 7:140652580-140652602 CAACATATGAATTTTGGAGGCGG - Intronic
1033574987 7:142672492-142672514 GAGCCTATGAAATATAGAGGTGG - Intergenic
1035565909 8:641083-641105 CAGCTTCTCACTTCTGGAGGTGG + Intronic
1038501502 8:28048310-28048332 CAACATTTGAATTTTGGAGGGGG - Intronic
1038501948 8:28052333-28052355 CAACATGTGAATTTTGGAGGGGG - Intronic
1039075599 8:33688198-33688220 CAACATATGAATTTTGGTGGGGG + Intergenic
1039758516 8:40548968-40548990 CAACATATGAATTCTGTGGGTGG - Intronic
1040996924 8:53411789-53411811 CACCCTATAAATACTGGAAGAGG - Intergenic
1041108562 8:54465179-54465201 CAGGGTCTGAATTCTTGAGGAGG + Intergenic
1045940086 8:107728600-107728622 CAGCCTATGATTTCAGAGGGTGG - Intergenic
1046875645 8:119251913-119251935 CAACATATGAATTCAGGTGGAGG - Intergenic
1047312488 8:123704381-123704403 CAGCATTTGAATTCTGCAGTCGG + Intronic
1048036623 8:130683216-130683238 CTGCTTTGGAATTCTGGAGGTGG + Intergenic
1048688425 8:136930522-136930544 TAGCCTCTGAATTCTTGGGGAGG + Intergenic
1048921693 8:139237283-139237305 CAACATATGAATTTTGGGGGCGG - Intergenic
1049487231 8:142872749-142872771 CAGCCTATGAATTCTGGAGGCGG - Intronic
1052462500 9:28784056-28784078 CATCCTATTAGTTTTGGAGGGGG + Intergenic
1056491127 9:87108170-87108192 CAGCCAATGACCTCTGGAGTTGG - Intergenic
1057177994 9:93013231-93013253 CAGCCTGTACATCCTGGAGGCGG - Intronic
1058048587 9:100383649-100383671 TAGCCTCTGAATTTTGGGGGAGG + Intergenic
1058725436 9:107799185-107799207 CCACCTTTGAATTCTAGAGGTGG + Intergenic
1058917580 9:109582302-109582324 AAGCGTTTGAACTCTGGAGGCGG + Intergenic
1059766535 9:117388838-117388860 TAGCCTGTGAATTCTGTTGGAGG - Intronic
1060098041 9:120811465-120811487 TAGCCTATAAATTCTGGAGGAGG - Intergenic
1062169738 9:135128394-135128416 TGGCCTGTGAATTCTGGAGCTGG + Intergenic
1203425020 Un_GL000195v1:30029-30051 CAGCTTCAGAATTCTGTAGGGGG - Intergenic
1186014934 X:5180734-5180756 CACCTTATGAATTCTGCAGTTGG + Intergenic
1186751000 X:12620917-12620939 CAGCCTATAAAGACTGGAAGAGG + Intronic
1188855047 X:35184039-35184061 CAACATATGAATTTTGGAGGGGG - Intergenic
1189470778 X:41312361-41312383 AAGCCACTGAATTTTGGAGGTGG + Intergenic
1189990323 X:46587936-46587958 CAGCCCATTTGTTCTGGAGGTGG + Intronic
1190022275 X:46890138-46890160 CTGCCTATGAGTGCTAGAGGAGG + Intronic
1192014766 X:67317492-67317514 CAGCCTGTGAAATCTGCAAGCGG + Intergenic
1192989271 X:76431440-76431462 CAGCCTCTGAATTCTTGGGCAGG - Intergenic
1194986095 X:100491218-100491240 CAGCCCATGCATCCTGCAGGGGG + Intergenic
1195332843 X:103819896-103819918 CAACCTATGAATTTTGGAGGGGG - Intergenic
1195656709 X:107338329-107338351 CAACATATGAATTTGGGAGGGGG - Intergenic
1196381671 X:115098133-115098155 CAACATATGAATTTTGGAGGTGG - Intergenic
1197136222 X:123062702-123062724 AAGCCAATTAATTGTGGAGGAGG - Intergenic
1197541325 X:127765209-127765231 CACCCTATAAAGTCTAGAGGAGG + Intergenic
1197867032 X:131029890-131029912 CAGCATGTGATTTGTGGAGGGGG + Intergenic
1198108155 X:133480324-133480346 CAGCCTAGGAGATCTGGAGTGGG + Intergenic
1198670227 X:139072092-139072114 CAGCATATGAATTTTGGGGAGGG - Intronic
1198692509 X:139299739-139299761 CTGCCTTTGACTTCTGGAGAGGG - Intergenic
1201665593 Y:16450034-16450056 CACCTTATGAATTCTGCAGGGGG + Intergenic
1201763273 Y:17560255-17560277 CAGCCCGTGCGTTCTGGAGGAGG - Intergenic
1201838280 Y:18345735-18345757 CAGCCCGTGCGTTCTGGAGGAGG + Intergenic