ID: 1049488108

View in Genome Browser
Species Human (GRCh38)
Location 8:142876874-142876896
Sequence CCAAGTTGCTGGCTGCGGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049488097_1049488108 8 Left 1049488097 8:142876843-142876865 CCAACCAGGCCCAGCCGCTCTCC 0: 2
1: 0
2: 0
3: 35
4: 438
Right 1049488108 8:142876874-142876896 CCAAGTTGCTGGCTGCGGGGAGG 0: 1
1: 1
2: 0
3: 15
4: 181
1049488099_1049488108 -1 Left 1049488099 8:142876852-142876874 CCCAGCCGCTCTCCAAAAAGAGC 0: 2
1: 0
2: 1
3: 13
4: 93
Right 1049488108 8:142876874-142876896 CCAAGTTGCTGGCTGCGGGGAGG 0: 1
1: 1
2: 0
3: 15
4: 181
1049488101_1049488108 -6 Left 1049488101 8:142876857-142876879 CCGCTCTCCAAAAAGAGCCAAGT 0: 1
1: 1
2: 2
3: 13
4: 246
Right 1049488108 8:142876874-142876896 CCAAGTTGCTGGCTGCGGGGAGG 0: 1
1: 1
2: 0
3: 15
4: 181
1049488098_1049488108 4 Left 1049488098 8:142876847-142876869 CCAGGCCCAGCCGCTCTCCAAAA 0: 2
1: 0
2: 0
3: 20
4: 224
Right 1049488108 8:142876874-142876896 CCAAGTTGCTGGCTGCGGGGAGG 0: 1
1: 1
2: 0
3: 15
4: 181
1049488100_1049488108 -2 Left 1049488100 8:142876853-142876875 CCAGCCGCTCTCCAAAAAGAGCC 0: 1
1: 1
2: 0
3: 7
4: 115
Right 1049488108 8:142876874-142876896 CCAAGTTGCTGGCTGCGGGGAGG 0: 1
1: 1
2: 0
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049488108 Original CRISPR CCAAGTTGCTGGCTGCGGGG AGG Exonic
901508392 1:9701033-9701055 CTATGCTGCTGGCTGCGGTGTGG - Intronic
903279714 1:22243671-22243693 TCAGGTTGCTGCCTGCAGGGAGG + Intergenic
903802844 1:25982583-25982605 CCAAGGTGCTTGCTGAGGCGTGG - Intronic
903907379 1:26696421-26696443 CCAGGCTGCTGGCGGCGGCGGGG - Exonic
904879406 1:33684044-33684066 CCCACTTGCTGGCTGGAGGGAGG + Intronic
905187513 1:36207253-36207275 CAAAGTTGCTGTTTGTGGGGAGG - Intergenic
906183136 1:43838670-43838692 CCAACTAGCTGGCTTCAGGGAGG + Intronic
908231562 1:62110645-62110667 CCCACTTGCAGACTGCGGGGAGG - Intronic
908669804 1:66533792-66533814 CTAAGTGGCTCGCTGCGGAGGGG - Intronic
919865921 1:201782822-201782844 CCAGCTTGGTGGCTGTGGGGTGG - Exonic
920201412 1:204261959-204261981 CCTAGTTGGTGGCTGCGAGCAGG + Intronic
920380722 1:205533174-205533196 CCAAGTTGGTGCCTGTGGGGTGG + Intergenic
920919732 1:210288596-210288618 CCAGGTTGGTGGCTGGGGTGGGG + Intergenic
1063379234 10:5574104-5574126 GGAAGTTGCTGGGTGCGTGGAGG - Intergenic
1070096339 10:73340995-73341017 CCATGATGCTGGCTGCAGTGGGG - Intronic
1073350086 10:102813339-102813361 CCAAGTTGCTGGGTGCTGGCAGG - Exonic
1074769155 10:116722298-116722320 CCACGGTGCTGACTGCTGGGAGG + Intronic
1075002819 10:118810538-118810560 CCAGGTTCCTGGCTGCAGAGAGG - Intergenic
1077185909 11:1235265-1235287 ACAAGCTGCTGGCCGCGGGCTGG - Intronic
1081488183 11:43547688-43547710 CCAGGTTGCGGGATGTGGGGGGG - Intergenic
1083915924 11:65743890-65743912 CCAAGATGCAGGCTGCAGCGTGG + Intergenic
1088707121 11:112474025-112474047 ACAAGTTCCTGGCTGTGAGGAGG - Intergenic
1090297546 11:125602323-125602345 CCAGGTTCCTGGCTGAGGAGGGG + Exonic
1093765083 12:22953134-22953156 CCAAGATGCTGGCTGCAGTGGGG - Intergenic
1095559749 12:43551549-43551571 ACGAGTTGGGGGCTGCGGGGAGG - Intronic
1096754643 12:53788825-53788847 CCAAGCTACTGACTGCAGGGTGG - Intergenic
1096856662 12:54488442-54488464 CCAACGGGGTGGCTGCGGGGCGG + Intergenic
1101764361 12:107684350-107684372 TCAAGTTGGTGGGGGCGGGGGGG + Intergenic
1102636228 12:114326624-114326646 CCAAGGTGCAGGCTGTGGCGGGG - Intergenic
1102789898 12:115636106-115636128 CCCAGTTCCTGGCTGGGGTGGGG + Intergenic
1110439251 13:75508484-75508506 CGAAGATGCTGGCTGCAGCGTGG - Intergenic
1111060841 13:83016840-83016862 CCAAGGTGCTTGCTGAGGGCAGG - Intergenic
1111843146 13:93474009-93474031 CCATGGTGCTGGCTGCAGTGGGG - Intronic
1112475815 13:99730091-99730113 CCCAGTTGCTGGCTGGAGGATGG + Intronic
1112507895 13:99985732-99985754 CCTCGCTGCTAGCTGCGGGGAGG - Exonic
1113884580 13:113651940-113651962 CCAAGTGGCTTGCTGATGGGTGG - Intronic
1114604917 14:23988759-23988781 GAAGGTAGCTGGCTGCGGGGCGG + Intronic
1115761675 14:36582674-36582696 CCAAGGGGCGGGGTGCGGGGCGG - Intergenic
1116616886 14:47150980-47151002 CCAACTAGCTGGCTGCAGTGAGG - Intronic
1116713487 14:48398478-48398500 ACAAGTTCCTGGCTGAGGAGGGG + Intergenic
1116902119 14:50371618-50371640 CCATGATGCTGGCTGCAGTGGGG + Intronic
1117508852 14:56428672-56428694 CCAAGTTGCAGGCTTCAGGGTGG - Intergenic
1121261265 14:92568117-92568139 CTAAATAGCTGGCTGCAGGGGGG + Intronic
1121280408 14:92693351-92693373 CCAAGTTCCTGGGTGGGGGCAGG + Intergenic
1128108059 15:65058810-65058832 CCAAGTCTCTGGCTGGGTGGTGG - Intronic
1130693219 15:86104398-86104420 CCCAGTTGATGGCTGCAGGTAGG + Intergenic
1130694721 15:86119541-86119563 CCCAGTTGATGGGTCCGGGGGGG - Intergenic
1131563195 15:93462176-93462198 TAAAGTGCCTGGCTGCGGGGTGG + Intergenic
1132490654 16:228913-228935 CCAGGTCGCTGGCAGCCGGGTGG - Intronic
1132597908 16:761614-761636 CCCATTTTCTGGCTGTGGGGGGG + Intronic
1135329021 16:21545812-21545834 CCTTGATGCTGGCTTCGGGGCGG - Intergenic
1135895873 16:26401956-26401978 CAAAGTTGCTGGCACCTGGGGGG + Intergenic
1136339367 16:29631789-29631811 CCTTGATGCTGGCTTCGGGGCGG - Intergenic
1137604281 16:49776642-49776664 GCAAGTTGGGGGTTGCGGGGCGG + Intronic
1141682698 16:85553640-85553662 CCGAGCTGCTGGCGGCGGCGGGG + Intergenic
1141830957 16:86509893-86509915 CCAGGTTGGTGGAGGCGGGGCGG + Intergenic
1142042034 16:87900376-87900398 CCTTGATGCTGGCTTCGGGGTGG - Intronic
1142325443 16:89411898-89411920 CCCAGTACCTGGCTGAGGGGAGG - Intronic
1142325462 16:89411959-89411981 CCCAGTACCTGGCTGAGGGGAGG - Intronic
1142325480 16:89412020-89412042 CCCAGTACCTGGCTGAGGGGAGG - Intronic
1142325496 16:89412081-89412103 CCCAGTAGCTGGCTGAGGGGAGG - Intronic
1142325514 16:89412142-89412164 CCCAGTACCTGGCTGAGGGGAGG - Intronic
1142325532 16:89412203-89412225 CCCAGTACCTGGCTGAGGGGAGG - Intronic
1142325550 16:89412264-89412286 CCCAGTACCTGGCTGAGGGGAGG - Intronic
1142325568 16:89412325-89412347 CCCAGTACCTGGCTGAGGGGAGG - Intronic
1142325586 16:89412386-89412408 CCCAGTACCTGGCTGAGGGGAGG - Intronic
1142848184 17:2692086-2692108 ACAAGGTGGTGGCTGCCGGGAGG + Exonic
1143371637 17:6444239-6444261 CCACGAGGCTGGCGGCGGGGCGG + Intergenic
1146425147 17:32731626-32731648 CCATGATGCTGGCTGCAGTGGGG + Intronic
1151465409 17:74281799-74281821 CCATGGTGCCGGCTGCTGGGGGG - Exonic
1151625276 17:75272073-75272095 CCAAGGTCCAGGCTGCGGCGGGG - Intergenic
1151968020 17:77441879-77441901 CCAAATTGCCGGCTGTGGGTGGG + Intronic
1151973859 17:77473106-77473128 ACAAGTTGCTGTTTGCGGAGTGG - Intronic
1152155622 17:78630759-78630781 CCAGGTGGCTCCCTGCGGGGAGG - Intergenic
1152246098 17:79185320-79185342 CCAAGTTACTGACAGCAGGGAGG - Intronic
1152524060 17:80877265-80877287 CCAGGTTCCTGCCTGCGGGGAGG + Intronic
1156244597 18:35285072-35285094 CCAAGATGCTGGCTGCAGCCAGG - Intronic
1156325533 18:36071506-36071528 CCAAGGGGCTGGGGGCGGGGGGG + Intergenic
1158787907 18:60739288-60739310 CAAAGATGCTGGCTGCAGCGGGG + Intergenic
1159456131 18:68662019-68662041 CGAATTTGATGGTTGCGGGGGGG + Intergenic
1159774411 18:72586181-72586203 CCATGTTGCTGGCTGCAGCAGGG - Intronic
1161249167 19:3271145-3271167 CCAAGGTGCTGGGAGGGGGGAGG + Intronic
1162034671 19:7932547-7932569 CCAGGGTGCCGGCTGCGGCGGGG + Intronic
1162451413 19:10757368-10757390 CCCAGTGGCTGGCGTCGGGGGGG - Intronic
1162797154 19:13092781-13092803 CCCAGGAGCTGGCTGCGGGCCGG + Intronic
1163624808 19:18383052-18383074 CCAGCTTCCTGGCTGCGGAGAGG - Intronic
1166862449 19:45818135-45818157 ACAGGTTGGTGGCTGCGAGGAGG + Exonic
1166939447 19:46353926-46353948 CCATGTTGCTGGCAGCCCGGCGG - Exonic
1168404003 19:56101367-56101389 CCAGGCAGCTGGCTCCGGGGAGG - Intronic
925459086 2:4044419-4044441 CCATGTTGTTGGCTGTGGGAAGG + Intergenic
926323695 2:11766389-11766411 CTAGGTTGCTGCCTGCAGGGTGG + Intronic
927402999 2:22735125-22735147 CCCAGTGGGTGGCTGCTGGGTGG - Intergenic
927664187 2:25018384-25018406 GAAAGTGGCTGGCTGTGGGGAGG + Intergenic
928452563 2:31389432-31389454 CAAGGTGGCTGGCTGGGGGGAGG - Intronic
928513020 2:32019241-32019263 CCAATTAGCTGGGTGCGGTGGGG - Intronic
928840323 2:35598416-35598438 CCATGATGCTGGCTGCAGTGGGG + Intergenic
929014444 2:37481129-37481151 CCAAGATGCTGACTGCAGCGGGG + Intergenic
929873558 2:45777776-45777798 CCAAGTTTCTGGCAGGGGGAAGG - Intronic
931082875 2:58795158-58795180 CCAAGTTACTGGATGTGGGGAGG - Intergenic
933465198 2:82642280-82642302 CCAAGCTGCTGGCTCTGGAGAGG + Intergenic
934636076 2:95991426-95991448 CCAGGCTGAGGGCTGCGGGGCGG - Intronic
934797570 2:97114000-97114022 CCAGGCTGAGGGCTGCGGGGCGG + Intronic
936376912 2:111948698-111948720 CCAGGGTGCTGGCAGCAGGGTGG - Intronic
938722205 2:134076751-134076773 CCATGATGCTGGCTGCAGTGGGG - Intergenic
939629272 2:144514877-144514899 CCAAGTTAGTGGCTGGGTGGAGG + Intronic
941432219 2:165426728-165426750 CCAAGATGCTGGCTGCAGCAGGG + Intergenic
942565035 2:177257649-177257671 CCCACCTGCTGGCTGCGGAGGGG + Intronic
943129235 2:183837191-183837213 CCATGATGCTGGCTGCAGTGGGG + Intergenic
945866550 2:215182503-215182525 CCCAGGTGGTGGCTGCGGGTTGG + Intergenic
946018157 2:216620707-216620729 CCAAGTAGCTGGCTAGGGGATGG + Intergenic
947538866 2:230960791-230960813 ACAAGTTGCCGGCTCCTGGGTGG - Intronic
948480792 2:238249064-238249086 CCACGTCGATGGCTGCGGGCAGG + Exonic
1168785329 20:534510-534532 CCACCTTGCTGGCTGGGGGCTGG + Intronic
1169189395 20:3648203-3648225 CCAAGGTGGTGGCTGTGAGGAGG + Exonic
1172695079 20:36816873-36816895 CTAAGTTCCTGGCTGGGGTGGGG + Intronic
1172938191 20:38635922-38635944 CCAAGTTGTTGGCTGAGTGTAGG + Intronic
1174378794 20:50143324-50143346 CCAAGTGACAGGCTGCAGGGAGG + Intronic
1175870997 20:62209449-62209471 CCAAGCTGAGAGCTGCGGGGAGG - Intergenic
1175940506 20:62535519-62535541 CCAAGAGGGTGGCTGAGGGGTGG + Intergenic
1176062640 20:63178995-63179017 CCGCGGTGCTGGCGGCGGGGCGG + Intergenic
1177037551 21:16061485-16061507 CAAAGATGCTGGCTGCAGCGGGG - Intergenic
1177344995 21:19855985-19856007 CAAAGATGCTGGCTGCAGTGGGG - Intergenic
1178513094 21:33223454-33223476 CCAAGTAGCTGGCTTCAGAGAGG + Intergenic
1180103572 21:45601817-45601839 CCAAGTGGCCGGCTGGGGAGGGG - Intergenic
950601247 3:14037427-14037449 CCAAGCTGCGCTCTGCGGGGAGG - Intronic
951698430 3:25469804-25469826 CCCAGCTGCTGGCTGCTTGGAGG + Intronic
954715574 3:52525136-52525158 GCCAGTTGCTGGGGGCGGGGGGG + Intronic
957613928 3:82505265-82505287 CCAACTTGGTGGCTGGGGTGGGG - Intergenic
960296230 3:115947886-115947908 CCAGGTAGCTGGCTGATGGGAGG + Intronic
961006907 3:123411591-123411613 ACATGTTGCTGGCTGGGGGTTGG - Intronic
961459840 3:127043272-127043294 CCCAGATGCTGCCTGCGGTGGGG + Intergenic
962825174 3:139094643-139094665 CCAAGGTTCTGGCGGGGGGGAGG + Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
967917271 3:194588016-194588038 CCAAGTGGGTGACTGGGGGGTGG + Exonic
980731052 4:136824371-136824393 CCATGATGCTGGCTGCAGTGGGG - Intergenic
982542828 4:156695883-156695905 CCAGGTTGCTGGCTGCTTAGAGG - Intergenic
983564277 4:169133048-169133070 CCAAATTGCTGGCAGCTGGAAGG - Intronic
985578062 5:682790-682812 CCATGTGGATGGCTGTGGGGTGG + Intronic
988940265 5:36138940-36138962 CAAAGTTGCTGGCCGCAGTGTGG + Intronic
990382474 5:55231125-55231147 GCAAGTGTCTGTCTGCGGGGAGG - Intergenic
992398348 5:76387909-76387931 CAAAGATGATGGCTGCCGGGTGG - Intergenic
992848328 5:80777730-80777752 CCAAGTTGCTGGATTAGGGGTGG - Intronic
998656793 5:144190085-144190107 CTAAGTGCCTGGCTGCGGGTGGG - Intronic
999887318 5:155937268-155937290 CCAAGATGCTGGCTGCAGTGGGG - Intronic
1001093486 5:168758668-168758690 CCAAGGTGGTGGCTGCAGGCAGG + Intronic
1002295952 5:178231609-178231631 CCCAGTTTCTGGTGGCGGGGGGG + Intronic
1002602689 5:180362981-180363003 ACAGGTTGCGGGCTGGGGGGCGG + Intergenic
1004487609 6:16082139-16082161 CCAAGCTGCTGGATCTGGGGTGG + Intergenic
1009847036 6:69146662-69146684 CCATGATGCTGGCTGCAGTGTGG - Intronic
1010519575 6:76817405-76817427 CCATGATGCTGGCTGCAGTGGGG + Intergenic
1013086915 6:106864598-106864620 CCAAGATGCTGGCTGCAGTGGGG - Intergenic
1015541413 6:134317796-134317818 CCAGGTAGCTGGGGGCGGGGAGG - Exonic
1015797058 6:137023595-137023617 CCAAGATGCAGGCTGTGGAGAGG + Intronic
1016663718 6:146610865-146610887 CCATGCTGCTGGTTGCAGGGTGG + Intronic
1017110655 6:150929054-150929076 GAAAGTTCCTGGCTGAGGGGAGG + Intronic
1018731980 6:166658225-166658247 CCAAGTTGATGGCCTCGGTGAGG + Intronic
1020256040 7:6503676-6503698 CCAAGAGGATGGCTGCGGGCGGG + Exonic
1024024412 7:45399152-45399174 CGAAGATGCTGGCTGCAGTGGGG + Intergenic
1024786361 7:52911716-52911738 CCATGATGCTGGCTGCAGTGGGG - Intergenic
1025106398 7:56174934-56174956 CCCACTTGCTGGCGGGGGGGTGG + Intergenic
1025126084 7:56346200-56346222 CAAAGTTGCGGGGGGCGGGGGGG + Intergenic
1026296269 7:69055173-69055195 CCTAGTTGCAGGCTGCGCAGTGG - Intergenic
1026392162 7:69912443-69912465 CCAAGATGCTGGCTGCAGCCGGG - Intronic
1026462269 7:70624992-70625014 CCAGGCTGCTGGCTGTGGAGTGG - Intronic
1027687511 7:81295441-81295463 CCAAGATGCTGGCTGCAGCGGGG - Intergenic
1032139235 7:129311575-129311597 CCAAGTTGCTGGCGCGGTGGGGG - Intronic
1032174401 7:129611906-129611928 GCAGGGTGCCGGCTGCGGGGCGG - Intronic
1034100518 7:148446150-148446172 CCCGGCTGCTGGCTGCAGGGAGG + Intergenic
1036586774 8:10131730-10131752 CCCAGTGGCTGGCTGCAGGGTGG - Intronic
1037755627 8:21708342-21708364 CTCATTTGCTGGCTGCGGAGGGG - Intronic
1038105966 8:24434477-24434499 CCAAGTTGCTAGCTGGGAGTGGG + Intergenic
1038235035 8:25745049-25745071 CCAAGTTGGTGGCTGAGGGTTGG - Intergenic
1039938129 8:42065931-42065953 CCAAGTAGCTTGCAGAGGGGAGG + Intergenic
1040068308 8:43167406-43167428 CCATGTTGATGGCTGCTGAGTGG - Intronic
1048491243 8:134895876-134895898 CCATGTTACTGGCTCCTGGGGGG - Intergenic
1049064826 8:140304823-140304845 CCTAGATGCTGGCAGCAGGGGGG + Intronic
1049384163 8:142332716-142332738 CCAAGATGCTGACTGAGGGGTGG - Intronic
1049488108 8:142876874-142876896 CCAAGTTGCTGGCTGCGGGGAGG + Exonic
1049492994 8:142914897-142914919 CTAAGTTGCTGGCTGCGGGGAGG + Exonic
1049700395 8:144008611-144008633 CCCAGTTCCTGGCTGCAGGGAGG - Intronic
1049783434 8:144439351-144439373 CCAGGTTGGTTGCTGGGGGGAGG - Intronic
1049924885 9:399279-399301 CCAAGTGGCTCGCTCGGGGGTGG - Intronic
1051918012 9:22230512-22230534 CCAGGTTGCTGGCTCTGGAGAGG + Intergenic
1053900671 9:42792885-42792907 CCAAGATGCTGGCTGCAGCAGGG + Intergenic
1056317346 9:85402825-85402847 CCAAGATGCTCGCAGCTGGGTGG - Intergenic
1056487410 9:87072949-87072971 GCCAGTTGCTGGGTGCGGGCAGG - Intergenic
1058897358 9:109411886-109411908 CCAAGTGGCTGGTTGGGGGTAGG + Intronic
1058914579 9:109553395-109553417 TCAGGTTGGTGGCTGGGGGGCGG - Intergenic
1061169733 9:128945609-128945631 CCAAGTAGCTGTCTGCTGTGGGG + Exonic
1061258151 9:129464844-129464866 CCACCTTGCTGGCTCCGGTGGGG - Intergenic
1061377923 9:130237004-130237026 CCAAGTGGCAGGCTCCGGGTGGG - Exonic
1061493735 9:130960124-130960146 CCCAGTTGCTGGCTTCTGGAGGG - Intergenic
1062401321 9:136373915-136373937 CAAAGTGGCTGGGTGCGGGCTGG - Intergenic
1186422772 X:9439572-9439594 GCAGGCTGCTGGCTGGGGGGCGG + Intergenic
1188651115 X:32632717-32632739 CCAGGACGCTGGGTGCGGGGGGG + Intronic
1196554502 X:117070754-117070776 CACAGTTGCTGGTTGGGGGGAGG + Intergenic
1198487497 X:137102993-137103015 GCTGGCTGCTGGCTGCGGGGGGG + Intergenic
1202130510 Y:21604786-21604808 CGAAGTTGCTGTCTCCGAGGTGG - Intergenic