ID: 1049491989

View in Genome Browser
Species Human (GRCh38)
Location 8:142910014-142910036
Sequence TACCCAGGGCTGCGAGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049491989_1049491995 25 Left 1049491989 8:142910014-142910036 CCTGTGACTCGCAGCCCTGGGTA 0: 1
1: 0
2: 2
3: 13
4: 117
Right 1049491995 8:142910062-142910084 CCTGCCTACCCTGCTTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049491989 Original CRISPR TACCCAGGGCTGCGAGTCAC AGG (reversed) Intronic
900120898 1:1048255-1048277 GAAGCAGGGCTGTGAGTCACAGG - Exonic
900370543 1:2330134-2330156 CCACCTGGGCTGCGAGTCACAGG + Intronic
900952157 1:5864240-5864262 TATCCAGTGGTCCGAGTCACAGG + Intronic
901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG + Intronic
901817070 1:11800404-11800426 CACCCAGGACTGCGAGTCCCTGG + Intronic
904264243 1:29309033-29309055 TGCTGAGGGCTGAGAGTCACTGG + Intronic
904896767 1:33823571-33823593 TACCCAACGCAGGGAGTCACAGG + Intronic
904928505 1:34067150-34067172 TACCCAGAGCTGTGAGTCATTGG - Intronic
906503157 1:46356981-46357003 TGCCCAGGGCTGAGATTCAGTGG + Intronic
907300663 1:53484631-53484653 TCCCCAGGGCTGAGAGGCAGGGG + Intergenic
908754761 1:67459197-67459219 GAGCCAGGGCTGCGAGTCAGCGG + Intergenic
913207461 1:116553697-116553719 TACACAGGTCTGGGACTCACAGG + Intronic
913439797 1:118885282-118885304 TACCCAGGGCTGAGTGACAGTGG - Exonic
915093703 1:153444446-153444468 TAGCCAGGTCTGAGACTCACTGG - Intergenic
915168617 1:153962732-153962754 TTCCTAGGTCTGAGAGTCACTGG - Exonic
916770703 1:167904782-167904804 TACTCAGGACTGCCAGTCATAGG - Intronic
918098463 1:181353391-181353413 AACCCAGTGCTGAGAGTCAAGGG + Intergenic
918428470 1:184434632-184434654 AACCCAGTGCTGCCACTCACAGG - Intronic
919806871 1:201385664-201385686 CACCCTGGTCTGCGAGCCACTGG - Intronic
920545376 1:206812206-206812228 TACACAGGTCTGCGAATCAGGGG + Intronic
920657558 1:207887958-207887980 TAAGCAGGGCTGTGAGACACTGG + Intronic
1066000157 10:31097113-31097135 TAGCCAGGGCTGAGAACCACAGG + Intergenic
1073043089 10:100620686-100620708 TCCCCTGGTCTGAGAGTCACAGG - Intergenic
1073523282 10:104155195-104155217 CACCCAGGGCAGCCAGTGACCGG - Intronic
1074529098 10:114284866-114284888 CTGGCAGGGCTGCGAGTCACAGG - Exonic
1076175966 10:128367946-128367968 TACCCAGGACTGAGAGTGAATGG - Intergenic
1076368276 10:129936005-129936027 TGCCCAGGGCTGCGAGTCAACGG + Intronic
1080758356 11:35223948-35223970 TTGCCAGGGCTGGTAGTCACAGG - Intronic
1082001970 11:47398188-47398210 TGCCCAGGGCTGAGAGCCAAGGG - Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083387335 11:62321324-62321346 TACCCAGGGCTGATAACCACAGG - Intergenic
1083573276 11:63771355-63771377 GACCCAGGGCACCGAGGCACTGG - Intergenic
1083652436 11:64211219-64211241 CCCCCAGGGCTGGGACTCACGGG - Intronic
1084953494 11:72679343-72679365 TACCCATGGCTGCTAGGCAGGGG + Intergenic
1088812727 11:113402353-113402375 CACCCAGGGCTGAGAAGCACTGG + Intergenic
1089180501 11:116580094-116580116 CTCCCTGGGCTGCGAGTCGCCGG - Intergenic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1097168714 12:57099976-57099998 TACCCAGGGTGGGGACTCACCGG + Exonic
1097463729 12:59896398-59896420 AACCCAGGGCAGGGAGGCACAGG - Intergenic
1098382016 12:69879434-69879456 TACCCAGGGCTGTGACACAGAGG - Intronic
1104719159 12:131035052-131035074 CACACAGGGCTGTGAGTCACAGG - Intronic
1112291161 13:98144440-98144462 TCCCCAGGGCTGGGAGAGACAGG - Intronic
1113158874 13:107356054-107356076 TACCCAGGGCCCCAACTCACAGG - Intronic
1121606213 14:95242104-95242126 CACCCAGGACTGAGAATCACAGG - Intronic
1123041050 14:105490372-105490394 GACCCCGGGCAGCGTGTCACCGG - Intronic
1123043232 14:105499116-105499138 TCCCCAGTGCTGCTAGCCACAGG - Exonic
1124226200 15:27897278-27897300 TACACAGGGCAGGGAGGCACTGG - Intronic
1127979697 15:64025444-64025466 TTCCCAGGGCTCTGAGTCCCTGG + Intronic
1136786976 16:32940561-32940583 TGCTCAGGGCTCCGAGCCACAGG + Intergenic
1136882796 16:33913228-33913250 TGCTCAGGGCTCCGAGCCACAGG - Intergenic
1141074714 16:80993587-80993609 CACACAGGGCTGGGAGTCAATGG + Intronic
1141707317 16:85674106-85674128 AGGCCAGGGCTGCCAGTCACTGG + Exonic
1203089213 16_KI270728v1_random:1202231-1202253 TGCTCAGGGCTCCGAGCCACAGG + Intergenic
1144644514 17:16963040-16963062 AACCCTGGGCTGTGAGTCATGGG + Intronic
1146725669 17:35153858-35153880 AACCCAGGGCTGAGAAACACAGG - Intronic
1147147324 17:38492701-38492723 TGCTCAGGGCTCCGAGCCACAGG + Intronic
1147763931 17:42820182-42820204 TACCCACAGCTGCCAGTCACTGG - Intronic
1150103925 17:62447928-62447950 TACCCATGGCAGCCAGGCACTGG + Intronic
1150657111 17:67046530-67046552 GTCCCAGGGCTGAGAGTGACAGG + Intronic
1152144799 17:78561695-78561717 TGCCCAGGGCTGTGACTCACGGG + Exonic
1156333597 18:36148715-36148737 TACCCAGGGCTGCAAGCCCATGG - Intronic
1157342576 18:46792317-46792339 CAGCCAGGGCTGGGAATCACTGG + Intergenic
1157815388 18:50726172-50726194 AACCCAGGGCTGCGAGCACCTGG - Exonic
1165112837 19:33512351-33512373 TGGCCATGGCTGAGAGTCACTGG - Intronic
1168310386 19:55456970-55456992 TAACCAGGGCTGACAGTAACCGG - Intronic
925918586 2:8624332-8624354 AAGCCAGGGCTCCGAGGCACAGG + Intergenic
928231434 2:29501855-29501877 TACCCAGGGCTGGGAGTAGGAGG - Intronic
932302864 2:70679269-70679291 CAGCCAGGGCTGGGAGCCACTGG - Intronic
933997071 2:87677838-87677860 CACACAGGGCTGCCATTCACAGG + Intergenic
935558466 2:104536692-104536714 TCCCCAGGGCTGTGTTTCACAGG + Intergenic
936296777 2:111273072-111273094 CACACAGGGCTGCCATTCACAGG - Intergenic
937914578 2:127092622-127092644 TGCCCGGGGCTGCGGGTCAGTGG - Intronic
944957419 2:204828377-204828399 TAGCCAGGGTTGAGAATCACTGG - Intronic
947890825 2:233617799-233617821 TGCCCATGGATGGGAGTCACTGG + Exonic
947892438 2:233636614-233636636 TGCCCATGGATGGGAGTCACTGG + Exonic
1168907467 20:1417732-1417754 TGCACAGGGCTGCAAATCACAGG + Intergenic
1171250632 20:23643758-23643780 AATCCAGGGCTGCGAGTGTCAGG - Intergenic
1173312416 20:41909790-41909812 TCCCCAGAGCTGCGTGTCAAGGG - Intergenic
1175536938 20:59721419-59721441 CACCCAGAGCTGGGAGTCACTGG - Intronic
1179549568 21:42135475-42135497 TTCCCAGGGCTGAGAGTCCAGGG + Intronic
1181019047 22:20088728-20088750 TACCTAGCCCTGAGAGTCACTGG + Intronic
1183098914 22:35571289-35571311 TCCCCAGGCCTCCGAGGCACCGG + Intergenic
1183655822 22:39184192-39184214 CACCCTGGGCTGGGAGACACTGG + Intergenic
1183999064 22:41659002-41659024 TACGCCCGGCTGCGAGTCGCTGG - Intronic
1184405227 22:44297046-44297068 TAACCAGGGCTGGGAGGCTCGGG - Intronic
1185192459 22:49447157-49447179 AACCCAGGGCCCTGAGTCACGGG + Intronic
1185311464 22:50158050-50158072 AACCCAGGGCAGCGAGGCACGGG + Exonic
949895855 3:8767242-8767264 TAGCCAGGGCTGGGAGACCCAGG - Intronic
950101451 3:10359368-10359390 TACCCAGGGCTGAGAACCACTGG + Intronic
951997497 3:28747365-28747387 TAACCAGGGCTGAGAGACAAGGG - Intergenic
954419938 3:50413395-50413417 GACCCAGGGCTGAGGGTCAGGGG - Intronic
955239185 3:57164803-57164825 GTCCCAGGGCTGCGTGTCCCGGG - Intronic
961204001 3:125066470-125066492 CAGCCAGGGCTGAGAATCACCGG - Intergenic
962696305 3:137950751-137950773 TTCCCTGGGCTAAGAGTCACAGG - Intergenic
969243717 4:5918944-5918966 CAACCAGGGCTGAGAATCACCGG + Intronic
973792967 4:54395167-54395189 TACCCATGGCTCTGAGGCACAGG - Intergenic
982060479 4:151599627-151599649 TACTCAGTGCTTCCAGTCACTGG + Intronic
982143483 4:152354723-152354745 TACTTAGGGCTGTGAGTTACAGG + Intronic
986286904 5:6365798-6365820 AGCACAGGGCTGTGAGTCACAGG + Intergenic
997195494 5:131976515-131976537 TAACCTGGGCTGCCATTCACAGG - Intronic
997718073 5:136056963-136056985 TTCCCAGGGTTGCTAGTCCCTGG - Intronic
999429194 5:151511452-151511474 CACCCAGGGGTGGAAGTCACAGG - Intronic
999608860 5:153347726-153347748 TAGCTAAGGCTGAGAGTCACTGG - Intergenic
1003569307 6:7246058-7246080 TCCCTAGCGCTGCGAGTCTCTGG + Intronic
1003615519 6:7651826-7651848 TAGCCAGGGTTGAGAATCACTGG - Intergenic
1004569857 6:16834670-16834692 CAGCCAGGGCTGAGAGCCACTGG + Intergenic
1004632615 6:17436518-17436540 TACCCAGGACTGCCAATCACAGG + Intronic
1008537741 6:52519978-52520000 TACCAAGGGCTGGGAGTGAGAGG + Intronic
1016838646 6:148504636-148504658 TGGCCAGGGCTGAGAGCCACAGG + Intronic
1017503058 6:155043246-155043268 TAGCCAGTGCTGAGAGCCACTGG - Intronic
1018639672 6:165895005-165895027 TAGCCAGGACTGAGAGCCACTGG + Intronic
1018872616 6:167795244-167795266 CACCCAGGGCCGCCATTCACGGG + Intronic
1019578679 7:1749621-1749643 TGCCCAGGGCTGAGAGTCCCGGG - Intergenic
1022531407 7:31069122-31069144 TACCCAGGTCTGAGAACCACTGG + Intronic
1030512090 7:110495014-110495036 TACCTGGGGATGGGAGTCACAGG - Intergenic
1031390065 7:121203030-121203052 TATCATGGGCTGCGAGTCAGTGG - Intronic
1032490176 7:132318485-132318507 TCCCCAGGGCTGGGAGCCAAGGG + Intronic
1035077668 7:156191680-156191702 TAGCCAGGTCAGGGAGTCACTGG + Intergenic
1036656300 8:10679550-10679572 TACCCAGGGCTGGAGGGCACAGG - Intronic
1041628808 8:60061729-60061751 TACCCAGTGCTTGGACTCACTGG - Intergenic
1047199058 8:122748571-122748593 GACCCAGGGTTGAGAGCCACTGG + Intergenic
1047764961 8:127982978-127983000 TACACAGGGCAGGGAGACACGGG + Intergenic
1049491989 8:142910014-142910036 TACCCAGGGCTGCGAGTCACAGG - Intronic
1051026202 9:12614687-12614709 TACCCAGGGCTGCTTATCACAGG - Intergenic
1051508599 9:17852235-17852257 TGCTCAGGGCTGAGAGCCACAGG + Intergenic
1052372980 9:27686851-27686873 TAGCCAGGGCTGAGAACCACTGG + Intergenic
1052442685 9:28518025-28518047 TACCCTTGGCAGTGAGTCACTGG + Intronic
1055470749 9:76607964-76607986 GACCCAGGGCTGCATGTCACTGG - Intergenic
1056020194 9:82432177-82432199 CACCCAGAGCTGCCAGCCACAGG - Intergenic
1056572252 9:87825865-87825887 CACCCAGAGCTGCCAGCCACAGG + Intergenic
1058828593 9:108796072-108796094 TCCCCAGGGATGCTGGTCACTGG + Intergenic
1059429465 9:114241252-114241274 AGCCCAGGGCTGTGTGTCACGGG - Intronic
1062122657 9:134842019-134842041 TACCCAGGGCTGCGCTTGCCCGG - Intronic