ID: 1049494773

View in Genome Browser
Species Human (GRCh38)
Location 8:142924528-142924550
Sequence CACAGGAGTCCCTGAAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049494773_1049494780 1 Left 1049494773 8:142924528-142924550 CCCCACTTTCAGGGACTCCTGTG No data
Right 1049494780 8:142924552-142924574 ACCAGGCTGGGCCAGCCCTCAGG No data
1049494773_1049494782 9 Left 1049494773 8:142924528-142924550 CCCCACTTTCAGGGACTCCTGTG No data
Right 1049494782 8:142924560-142924582 GGGCCAGCCCTCAGGCCTGCAGG No data
1049494773_1049494787 30 Left 1049494773 8:142924528-142924550 CCCCACTTTCAGGGACTCCTGTG No data
Right 1049494787 8:142924581-142924603 GGAGAACTTTCCACCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049494773 Original CRISPR CACAGGAGTCCCTGAAAGTG GGG (reversed) Intergenic
No off target data available for this crispr