ID: 1049494932

View in Genome Browser
Species Human (GRCh38)
Location 8:142925450-142925472
Sequence TCGGGTTCACATGAAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049494926_1049494932 24 Left 1049494926 8:142925403-142925425 CCAGGCACATGCGAGGTGAGTTT No data
Right 1049494932 8:142925450-142925472 TCGGGTTCACATGAAGATGAGGG No data
1049494928_1049494932 -2 Left 1049494928 8:142925429-142925451 CCACTGTGGAGATGAATTCTTTC No data
Right 1049494932 8:142925450-142925472 TCGGGTTCACATGAAGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049494932 Original CRISPR TCGGGTTCACATGAAGATGA GGG Intergenic
No off target data available for this crispr