ID: 1049495186

View in Genome Browser
Species Human (GRCh38)
Location 8:142926900-142926922
Sequence CAGAAGGAGGAGACGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049495186_1049495197 17 Left 1049495186 8:142926900-142926922 CCTGCATCCGTCTCCTCCTTCTG No data
Right 1049495197 8:142926940-142926962 CTGAGGGCAGCCTATTGACCAGG No data
1049495186_1049495190 0 Left 1049495186 8:142926900-142926922 CCTGCATCCGTCTCCTCCTTCTG No data
Right 1049495190 8:142926923-142926945 TGCTCCAGTCCCTCTCCCTGAGG No data
1049495186_1049495191 1 Left 1049495186 8:142926900-142926922 CCTGCATCCGTCTCCTCCTTCTG No data
Right 1049495191 8:142926924-142926946 GCTCCAGTCCCTCTCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049495186 Original CRISPR CAGAAGGAGGAGACGGATGC AGG (reversed) Intergenic
No off target data available for this crispr