ID: 1049497335

View in Genome Browser
Species Human (GRCh38)
Location 8:142942422-142942444
Sequence CAGCTGGTCGAGGGGAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049497335_1049497341 1 Left 1049497335 8:142942422-142942444 CCATGGCTCCCCTCGACCAGCTG No data
Right 1049497341 8:142942446-142942468 AAACACTTAACTCACAGGAATGG No data
1049497335_1049497343 12 Left 1049497335 8:142942422-142942444 CCATGGCTCCCCTCGACCAGCTG No data
Right 1049497343 8:142942457-142942479 TCACAGGAATGGCCACTGCTGGG No data
1049497335_1049497342 11 Left 1049497335 8:142942422-142942444 CCATGGCTCCCCTCGACCAGCTG No data
Right 1049497342 8:142942456-142942478 CTCACAGGAATGGCCACTGCTGG No data
1049497335_1049497340 -4 Left 1049497335 8:142942422-142942444 CCATGGCTCCCCTCGACCAGCTG No data
Right 1049497340 8:142942441-142942463 GCTGCAAACACTTAACTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049497335 Original CRISPR CAGCTGGTCGAGGGGAGCCA TGG (reversed) Intergenic
No off target data available for this crispr