ID: 1049499550

View in Genome Browser
Species Human (GRCh38)
Location 8:142954479-142954501
Sequence AGTTGTGGATATTCATCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049499550_1049499555 27 Left 1049499550 8:142954479-142954501 CCATTTGATGAATATCCACAACT No data
Right 1049499555 8:142954529-142954551 GTTGTGTCATTTCCAGATTGGGG No data
1049499550_1049499554 26 Left 1049499550 8:142954479-142954501 CCATTTGATGAATATCCACAACT No data
Right 1049499554 8:142954528-142954550 AGTTGTGTCATTTCCAGATTGGG No data
1049499550_1049499552 1 Left 1049499550 8:142954479-142954501 CCATTTGATGAATATCCACAACT No data
Right 1049499552 8:142954503-142954525 ATTATCTTGTCTTCTGTCAACGG No data
1049499550_1049499553 25 Left 1049499550 8:142954479-142954501 CCATTTGATGAATATCCACAACT No data
Right 1049499553 8:142954527-142954549 CAGTTGTGTCATTTCCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049499550 Original CRISPR AGTTGTGGATATTCATCAAA TGG (reversed) Intergenic