ID: 1049499551

View in Genome Browser
Species Human (GRCh38)
Location 8:142954494-142954516
Sequence GAAGACAAGATAATAAGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049499551_1049499555 12 Left 1049499551 8:142954494-142954516 CCACAACTTATTATCTTGTCTTC No data
Right 1049499555 8:142954529-142954551 GTTGTGTCATTTCCAGATTGGGG No data
1049499551_1049499553 10 Left 1049499551 8:142954494-142954516 CCACAACTTATTATCTTGTCTTC No data
Right 1049499553 8:142954527-142954549 CAGTTGTGTCATTTCCAGATTGG No data
1049499551_1049499554 11 Left 1049499551 8:142954494-142954516 CCACAACTTATTATCTTGTCTTC No data
Right 1049499554 8:142954528-142954550 AGTTGTGTCATTTCCAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049499551 Original CRISPR GAAGACAAGATAATAAGTTG TGG (reversed) Intergenic
No off target data available for this crispr