ID: 1049499552

View in Genome Browser
Species Human (GRCh38)
Location 8:142954503-142954525
Sequence ATTATCTTGTCTTCTGTCAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049499550_1049499552 1 Left 1049499550 8:142954479-142954501 CCATTTGATGAATATCCACAACT No data
Right 1049499552 8:142954503-142954525 ATTATCTTGTCTTCTGTCAACGG No data
1049499549_1049499552 13 Left 1049499549 8:142954467-142954489 CCGAGTAGCATTCCATTTGATGA No data
Right 1049499552 8:142954503-142954525 ATTATCTTGTCTTCTGTCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049499552 Original CRISPR ATTATCTTGTCTTCTGTCAA CGG Intergenic
No off target data available for this crispr