ID: 1049499553

View in Genome Browser
Species Human (GRCh38)
Location 8:142954527-142954549
Sequence CAGTTGTGTCATTTCCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049499550_1049499553 25 Left 1049499550 8:142954479-142954501 CCATTTGATGAATATCCACAACT No data
Right 1049499553 8:142954527-142954549 CAGTTGTGTCATTTCCAGATTGG No data
1049499551_1049499553 10 Left 1049499551 8:142954494-142954516 CCACAACTTATTATCTTGTCTTC No data
Right 1049499553 8:142954527-142954549 CAGTTGTGTCATTTCCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049499553 Original CRISPR CAGTTGTGTCATTTCCAGAT TGG Intergenic
No off target data available for this crispr