ID: 1049499631

View in Genome Browser
Species Human (GRCh38)
Location 8:142955022-142955044
Sequence CTGTGAGGGTGTAAGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049499631_1049499647 25 Left 1049499631 8:142955022-142955044 CCCCCTTCCTTACACCCTCACAG No data
Right 1049499647 8:142955070-142955092 GGCAGGTCAGACTCTAACACAGG No data
1049499631_1049499642 4 Left 1049499631 8:142955022-142955044 CCCCCTTCCTTACACCCTCACAG No data
Right 1049499642 8:142955049-142955071 GGGCTCGAAAGCCCCTTAATGGG No data
1049499631_1049499643 8 Left 1049499631 8:142955022-142955044 CCCCCTTCCTTACACCCTCACAG No data
Right 1049499643 8:142955053-142955075 TCGAAAGCCCCTTAATGGGCAGG No data
1049499631_1049499641 3 Left 1049499631 8:142955022-142955044 CCCCCTTCCTTACACCCTCACAG No data
Right 1049499641 8:142955048-142955070 AGGGCTCGAAAGCCCCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049499631 Original CRISPR CTGTGAGGGTGTAAGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr