ID: 1049500194

View in Genome Browser
Species Human (GRCh38)
Location 8:142958933-142958955
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049500194_1049500198 -8 Left 1049500194 8:142958933-142958955 CCTTTTGGTCTCTGCCTTCGGGG No data
Right 1049500198 8:142958948-142958970 CTTCGGGGAAGAGGAATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049500194 Original CRISPR CCCCGAAGGCAGAGACCAAA AGG (reversed) Intergenic
No off target data available for this crispr