ID: 1049500900

View in Genome Browser
Species Human (GRCh38)
Location 8:142964954-142964976
Sequence AAATCACTAGGGTATTGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049500893_1049500900 25 Left 1049500893 8:142964906-142964928 CCTCCTCAGCTGACAGGATTAAA No data
Right 1049500900 8:142964954-142964976 AAATCACTAGGGTATTGATTGGG No data
1049500894_1049500900 22 Left 1049500894 8:142964909-142964931 CCTCAGCTGACAGGATTAAAAGA 0: 3
1: 145
2: 100
3: 51
4: 227
Right 1049500900 8:142964954-142964976 AAATCACTAGGGTATTGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049500900 Original CRISPR AAATCACTAGGGTATTGATT GGG Intergenic
No off target data available for this crispr