ID: 1049504443

View in Genome Browser
Species Human (GRCh38)
Location 8:142988248-142988270
Sequence TTCTTGCCTTCTCCTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049504436_1049504443 13 Left 1049504436 8:142988212-142988234 CCCTTAAGCGAGTTACAGGCTGC No data
Right 1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG No data
1049504434_1049504443 17 Left 1049504434 8:142988208-142988230 CCTGCCCTTAAGCGAGTTACAGG No data
Right 1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG No data
1049504437_1049504443 12 Left 1049504437 8:142988213-142988235 CCTTAAGCGAGTTACAGGCTGCG No data
Right 1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049504443 Original CRISPR TTCTTGCCTTCTCCTGAGGG TGG Intergenic
No off target data available for this crispr