ID: 1049504706

View in Genome Browser
Species Human (GRCh38)
Location 8:142989917-142989939
Sequence GACACAGTGCACCAAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049504701_1049504706 22 Left 1049504701 8:142989872-142989894 CCACCTGTGTGTCTAATTCAAAA No data
Right 1049504706 8:142989917-142989939 GACACAGTGCACCAAGAGCCTGG No data
1049504702_1049504706 19 Left 1049504702 8:142989875-142989897 CCTGTGTGTCTAATTCAAAAAGC No data
Right 1049504706 8:142989917-142989939 GACACAGTGCACCAAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049504706 Original CRISPR GACACAGTGCACCAAGAGCC TGG Intergenic
No off target data available for this crispr