ID: 1049508977 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:143018419-143018441 |
Sequence | CGGAGTCGGCGAGCCCGCGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 118 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 18, 4: 98} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049508977_1049508991 | 22 | Left | 1049508977 | 8:143018419-143018441 | CCACCGCGGGCTCGCCGACTCCG | 0: 1 1: 0 2: 1 3: 18 4: 98 |
||
Right | 1049508991 | 8:143018464-143018486 | TCCCGCCCCTGCCCCCGCCCCGG | 0: 1 1: 5 2: 40 3: 222 4: 1466 |
||||
1049508977_1049508995 | 24 | Left | 1049508977 | 8:143018419-143018441 | CCACCGCGGGCTCGCCGACTCCG | 0: 1 1: 0 2: 1 3: 18 4: 98 |
||
Right | 1049508995 | 8:143018466-143018488 | CCGCCCCTGCCCCCGCCCCGGGG | 0: 1 1: 7 2: 40 3: 176 4: 1120 |
||||
1049508977_1049508993 | 23 | Left | 1049508977 | 8:143018419-143018441 | CCACCGCGGGCTCGCCGACTCCG | 0: 1 1: 0 2: 1 3: 18 4: 98 |
||
Right | 1049508993 | 8:143018465-143018487 | CCCGCCCCTGCCCCCGCCCCGGG | 0: 2 1: 18 2: 76 3: 476 4: 2362 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049508977 | Original CRISPR | CGGAGTCGGCGAGCCCGCGG TGG (reversed) | Intronic | ||