ID: 1049508977

View in Genome Browser
Species Human (GRCh38)
Location 8:143018419-143018441
Sequence CGGAGTCGGCGAGCCCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049508977_1049508991 22 Left 1049508977 8:143018419-143018441 CCACCGCGGGCTCGCCGACTCCG 0: 1
1: 0
2: 1
3: 18
4: 98
Right 1049508991 8:143018464-143018486 TCCCGCCCCTGCCCCCGCCCCGG 0: 1
1: 5
2: 40
3: 222
4: 1466
1049508977_1049508995 24 Left 1049508977 8:143018419-143018441 CCACCGCGGGCTCGCCGACTCCG 0: 1
1: 0
2: 1
3: 18
4: 98
Right 1049508995 8:143018466-143018488 CCGCCCCTGCCCCCGCCCCGGGG 0: 1
1: 7
2: 40
3: 176
4: 1120
1049508977_1049508993 23 Left 1049508977 8:143018419-143018441 CCACCGCGGGCTCGCCGACTCCG 0: 1
1: 0
2: 1
3: 18
4: 98
Right 1049508993 8:143018465-143018487 CCCGCCCCTGCCCCCGCCCCGGG 0: 2
1: 18
2: 76
3: 476
4: 2362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049508977 Original CRISPR CGGAGTCGGCGAGCCCGCGG TGG (reversed) Intronic