ID: 1049509631

View in Genome Browser
Species Human (GRCh38)
Location 8:143021011-143021033
Sequence GCACAGCTGGACAAAGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049509631_1049509644 25 Left 1049509631 8:143021011-143021033 CCCAGACCTTTGTCCAGCTGTGC 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1049509644 8:143021059-143021081 CTCCCCTGAGCAGACGCCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 243
1049509631_1049509645 26 Left 1049509631 8:143021011-143021033 CCCAGACCTTTGTCCAGCTGTGC 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1049509645 8:143021060-143021082 TCCCCTGAGCAGACGCCCCAGGG 0: 1
1: 0
2: 3
3: 15
4: 155
1049509631_1049509647 27 Left 1049509631 8:143021011-143021033 CCCAGACCTTTGTCCAGCTGTGC 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1049509647 8:143021061-143021083 CCCCTGAGCAGACGCCCCAGGGG 0: 1
1: 0
2: 1
3: 18
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049509631 Original CRISPR GCACAGCTGGACAAAGGTCT GGG (reversed) Intronic
901451370 1:9338621-9338643 TCACAGCTGGAAAAGGGTCTGGG + Intronic
902810453 1:18885199-18885221 GCAAAGCATGACAAAGGCCTAGG + Intronic
903214969 1:21838832-21838854 GAGCAGCTGGGCAAAGGCCTCGG + Exonic
903942362 1:26940551-26940573 GCATAGCTGGACTGTGGTCTTGG + Intronic
904205114 1:28849277-28849299 GCAGAGCTGGAGAAAGGGCCCGG - Intronic
904314361 1:29650710-29650732 GCACAGATGGACACAGGCCAGGG - Intergenic
904702429 1:32365912-32365934 GCACAGCTGGGCTAAGGACTTGG + Intronic
904805367 1:33127566-33127588 GCTCAGCTGGAAAAAGGCCCAGG + Intergenic
905797126 1:40822214-40822236 CCACAACTGGACCAAGGACTGGG + Intronic
906560733 1:46755008-46755030 GCACACCTGAACAAAGGGCATGG - Intergenic
907787011 1:57622357-57622379 GCAGAGCTGGACATAGATATGGG + Intronic
907962981 1:59299681-59299703 GCACACCTGGACAAGGGTGGGGG + Intronic
915318653 1:155043934-155043956 GCCCAGCTGGACACTGGGCTGGG - Intronic
915748244 1:158181558-158181580 GCACAGCTGGAGCAACGACTCGG + Exonic
918653216 1:186991575-186991597 GCACAGCTGGACACAGCAGTTGG + Intergenic
922056082 1:222043768-222043790 GCACACATGAGCAAAGGTCTGGG + Intergenic
922229085 1:223670153-223670175 GCTCAGCTTGACAAAGTGCTGGG - Intergenic
924043187 1:240003720-240003742 GCAGATCTGGACACAGGTCTGGG + Intergenic
1067295293 10:44972131-44972153 GTTCACATGGACAAAGGTCTCGG - Intronic
1067711635 10:48655556-48655578 GCACAGCTGGGCACAGTTCCCGG + Intronic
1068092469 10:52449771-52449793 GAAAAGCTGGAAAAAGGTCTTGG - Intergenic
1069823108 10:71239647-71239669 GCACTGCTGAACAGAGGACTGGG - Intronic
1072169643 10:92847481-92847503 ACACAGCTGGATAAAGAGCTTGG + Intronic
1073845454 10:107548672-107548694 GCACAGCCTGTCAAAGCTCTAGG - Intergenic
1076525887 10:131112236-131112258 GCACATCTGGACAGAGCTCGGGG - Intronic
1076907873 10:133372578-133372600 GCCCAGTTGGCCAGAGGTCTTGG + Intronic
1077504884 11:2925346-2925368 CTACAGCTGGGCAAAGCTCTGGG + Intergenic
1081481528 11:43494169-43494191 GCACAGCTCCAGAAATGTCTTGG - Exonic
1083486836 11:62988456-62988478 GGACAGCTGGACAAACAGCTTGG + Intergenic
1083758826 11:64805006-64805028 GGACAGCTGCACAGAGGTCTGGG - Intronic
1084651439 11:70491764-70491786 ACACAGCTGGAAAAGGGCCTGGG - Intronic
1085026166 11:73237864-73237886 TCACTGCTGGACAATGGTCTGGG - Intergenic
1085026655 11:73240326-73240348 TCACTGCTGGACAATGGTCCAGG - Intergenic
1085808098 11:79655098-79655120 GAACATCTGCACAAAGTTCTAGG - Intergenic
1088503436 11:110506943-110506965 GCACCTCTGAACAAAGGTTTGGG + Intergenic
1089127062 11:116183997-116184019 TCACAGCTGGACAGAGGTTCTGG + Intergenic
1089774909 11:120829273-120829295 TCCTACCTGGACAAAGGTCTGGG - Intronic
1091891153 12:4055578-4055600 GCCCAGCTGGAGAAAGGCCCAGG - Intergenic
1092100825 12:5882573-5882595 GGACAACTGGCCAAAGGACTGGG + Intronic
1092584861 12:9888880-9888902 GCACTGGTGGAGAAAGGTATGGG + Intronic
1095715981 12:45346330-45346352 GCACAGCTTGGCAAAAGCCTAGG + Intronic
1100072805 12:90741836-90741858 GCACAGCTGAGCAGATGTCTTGG + Intergenic
1101417361 12:104519994-104520016 GCACAGCTGTGCAAGGGACTGGG + Intronic
1101486880 12:105173488-105173510 GCACAGCTGGTCATGGGGCTTGG - Intronic
1102332884 12:112050201-112050223 GCAGAGCTAGACAAGGGCCTGGG + Intronic
1103913815 12:124365809-124365831 GCACAGCTGGGCCCAGGTCCAGG - Intronic
1104044231 12:125150444-125150466 GCACAGCAGGATATAGGGCTGGG + Intergenic
1104598193 12:130134102-130134124 CCACAGCTGCACAGAGGCCTGGG + Intergenic
1105426900 13:20302013-20302035 GAACGGCTGGGGAAAGGTCTCGG - Intergenic
1105894585 13:24707327-24707349 GCACAGCTCGGCAATGTTCTTGG - Exonic
1107803747 13:44134640-44134662 ATACAGGTGGACAAAAGTCTGGG - Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112783710 13:102929200-102929222 GTTCAGCTGGAAAAAGGACTGGG + Intergenic
1113064426 13:106359014-106359036 GCACAGCTGGCCTGAGGTCAAGG - Intergenic
1115177940 14:30586265-30586287 GCCCAGCTGGGCAGTGGTCTTGG - Intronic
1116399638 14:44490337-44490359 GCAGAGGAGGACAATGGTCTTGG + Intergenic
1118765863 14:68908912-68908934 GCACAGCAGGTCAAAGGACAAGG + Intronic
1123087108 14:105721750-105721772 GCACAGCTGGACGGAGCCCTGGG + Intergenic
1123121344 14:105918446-105918468 GCAGAGCTGGTCAAAGGTGGAGG - Exonic
1127378576 15:58407887-58407909 GTACATCTGGGCAAGGGTCTCGG - Intronic
1129249560 15:74301385-74301407 CCCCAGCTGGACACAGGGCTGGG - Intronic
1129601657 15:77002580-77002602 GCACAGATGAACGAAGTTCTTGG - Intronic
1130038652 15:80384904-80384926 ACACAGCTGGTAAAAGGTTTGGG - Intronic
1132228689 15:100165271-100165293 GCACAGCTGGACACAGGACTGGG + Intronic
1132408791 15:101561381-101561403 GCACAGGCGCACAAAGTTCTGGG + Intergenic
1132669187 16:1095712-1095734 GCTCTGCTGGACAAAGATCTAGG + Exonic
1136090695 16:27917816-27917838 GCACAGCTAGACGGAGGACTCGG + Intronic
1139173051 16:64653933-64653955 GCACTTCTGGACATAGGCCTTGG + Intergenic
1139259363 16:65577144-65577166 GCACCACTGCACTAAGGTCTGGG + Intergenic
1139367652 16:66443472-66443494 CCACAGCTGGAAAAAGGACAAGG + Intronic
1141139645 16:81489120-81489142 GCCCAGCTGGTCCAAGGCCTTGG + Intronic
1142799300 17:2335554-2335576 GCACAGCAGCATAAAGTTCTGGG + Exonic
1144010540 17:11144447-11144469 GCATAGCCGAAGAAAGGTCTTGG + Intergenic
1144765753 17:17731551-17731573 GCACCGCTGGAGCAAAGTCTCGG + Intronic
1144864781 17:18328491-18328513 TCACAGCTGGACATAATTCTAGG - Exonic
1145377361 17:22363096-22363118 GCAGAGCTGGAGTAAGGACTTGG - Intergenic
1146923670 17:36729931-36729953 GCAGAACTGGACAAAGGACCGGG + Intergenic
1148834665 17:50459746-50459768 GCACAGGTGGAAACAGGTCTGGG - Intronic
1149004521 17:51791200-51791222 GAAGAGCTAGACTAAGGTCTAGG + Intronic
1151862849 17:76778389-76778411 ACACAGCTGGACACAGAGCTTGG + Exonic
1154261530 18:12838356-12838378 GCATAGCTGGGCAAGGGTGTGGG - Intronic
1155592215 18:27440336-27440358 ACTCAGCTGGATATAGGTCTAGG + Intergenic
1156799839 18:41096674-41096696 GCACACCCAGACAAAGGGCTTGG - Intergenic
1160778654 19:868173-868195 GCCCAGCTGGACAAAGGCAGGGG + Exonic
1161398216 19:4055921-4055943 GCACAGATGGAAAACAGTCTTGG - Intronic
1161589316 19:5121908-5121930 GCAAAGATGGCAAAAGGTCTAGG + Intronic
1165712590 19:38022818-38022840 GCACAGCCGCACATGGGTCTGGG + Intronic
925630216 2:5884327-5884349 GAACAGCTGTAGAAAGGACTCGG + Intergenic
927026306 2:19072464-19072486 ACACATCTGGAGAAAGGGCTTGG - Intergenic
927835686 2:26396794-26396816 GCACAGCTGGAGAACAGCCTGGG - Intergenic
928424275 2:31165317-31165339 GCACTGCTGGACACAGGGCAGGG - Intergenic
929620286 2:43347825-43347847 ACACAGCTGGAGAAAGGAGTCGG + Intronic
930033101 2:47070095-47070117 GCAGAGCAGCACAAAGGTCTAGG - Intronic
932783494 2:74579000-74579022 GCACAGCTGGAATGAGGTCTGGG - Intronic
934602478 2:95668139-95668161 GAACAGCTGGACAATGCTCCTGG + Intergenic
934725587 2:96616103-96616125 GCACAGATGGACAAAAGTCAAGG + Intronic
936400932 2:112163952-112163974 GCACAGCCAGACAGATGTCTGGG - Intronic
937059010 2:118967658-118967680 GCCCAGATGAACAATGGTCTAGG - Intronic
937221335 2:120344649-120344671 GCCCAGCTGGGCAAGGGTCCGGG + Intergenic
938530428 2:132180159-132180181 GCACAGCTGGAAATTGCTCTGGG - Intronic
942147874 2:173043948-173043970 GCTCAGCTGGAGAGAGTTCTTGG + Intronic
944347343 2:198684817-198684839 ACAAAACTGGACAAAGGTTTGGG + Intergenic
947727851 2:232410859-232410881 GCACAGCAGCACAAAGGCCCTGG + Intergenic
948027418 2:234789262-234789284 GCACAGAAGGACAGGGGTCTTGG - Intergenic
948237198 2:236400129-236400151 GCACAGCTCAGCAAAGGACTCGG - Intronic
948553427 2:238791379-238791401 GCCCAGCTGGTCAAAGGCATCGG + Intergenic
948755951 2:240159626-240159648 GAACCGCTGGACAAAGGCCGGGG - Intergenic
949036226 2:241816802-241816824 GCGCAGCTGGACAGAGCCCTGGG + Exonic
1170552586 20:17490282-17490304 GCAGACCCGGAGAAAGGTCTTGG - Intergenic
1171526135 20:25813008-25813030 GCAGAGCTGGAGTAAGGACTTGG + Intronic
1171535035 20:25879930-25879952 GCAGAGCTGGAGAAAAGACTTGG + Intergenic
1171550692 20:26042877-26042899 GCAGAGCTGGAGTAAGGACTTGG - Intergenic
1172486744 20:35303050-35303072 CCAAAGCTGGGCACAGGTCTGGG + Exonic
1172637752 20:36421413-36421435 GCACAACTGTACTATGGTCTGGG + Intronic
1172931574 20:38589897-38589919 GCACAGCGGGGCAAAGGACTGGG - Intergenic
1173044144 20:39493381-39493403 GCATACCTGGAGAAAGATCTGGG + Intergenic
1174076383 20:47940335-47940357 GCACAGCTGAACAAAGGCTGGGG + Intergenic
1175422300 20:58841964-58841986 GCAGAGCTGGGGAAAGGTGTTGG + Intronic
1176215492 20:63945804-63945826 GCACAGCCGGAAGAAGGACTGGG - Exonic
1183472301 22:38016198-38016220 GCACAGCTGGGCCAAAGCCTGGG + Intronic
1183592084 22:38785250-38785272 TCACACCTGGACAAAGGTAGAGG - Intronic
1184244898 22:43230976-43230998 GCACAGCTGGATAATCGTCAGGG + Intronic
1184510023 22:44927967-44927989 GCACAGCTGGGGAAATCTCTAGG + Intronic
1185041258 22:48505592-48505614 CCACAGGTGGACAAAGCTGTAGG - Intronic
953018601 3:39099995-39100017 GCAAAACTGGACAAAGGGCTAGG - Intronic
954351365 3:50046827-50046849 GCACAGCTGGACTTACATCTGGG - Intronic
960974756 3:123163096-123163118 GCACCGCTGGGCACAGGGCTGGG - Intronic
961033105 3:123623611-123623633 GCACAGCTGCAGAGAGTTCTGGG + Intronic
962105716 3:132386618-132386640 GCCCAGCTGGGCAGTGGTCTTGG - Intergenic
962410102 3:135133419-135133441 GGACAGATGGACAGAGGGCTAGG + Intronic
964384046 3:156128240-156128262 TCAAAGCTGGACAAAGCTCAAGG - Intronic
964496741 3:157299306-157299328 CCTCAGCTGCCCAAAGGTCTGGG - Intronic
964819774 3:160756376-160756398 GCACAGCAGGAAAAGCGTCTCGG - Exonic
967825683 3:193875483-193875505 GAACACCTGGAGAAAGGCCTCGG - Intergenic
969563365 4:7963256-7963278 GCCCAGCTGCAAAAGGGTCTAGG - Intergenic
973990774 4:56404759-56404781 ACAGGGCTGGACAAAGCTCTAGG + Intronic
974937555 4:68426127-68426149 GAACAGCTGGACACAGGGCGGGG + Intergenic
977866549 4:102035217-102035239 ACAGAACTGGACAAAGCTCTAGG + Intronic
978651873 4:111015234-111015256 GCACAGCTAGACAGGTGTCTGGG - Intergenic
978807518 4:112816026-112816048 GCCAAGCTGGACAAAAGTGTGGG + Intergenic
979230363 4:118342094-118342116 CCACAGCTGTACAAAGTTGTAGG + Intronic
979936614 4:126705628-126705650 GCAAAGCTTGACATTGGTCTGGG - Intergenic
985194427 4:187412949-187412971 GTACAGCTAGATAAAGGTCAAGG - Intergenic
986132848 5:4946845-4946867 GCACTGCTCCACAAAGGCCTGGG - Intergenic
986582559 5:9280416-9280438 GCACATCTGGACACAGGACTTGG + Intronic
991577770 5:68122653-68122675 GCACTGGCGGACACAGGTCTGGG - Intergenic
991636323 5:68709613-68709635 GGACAGCTGGAAAAAGCCCTTGG - Intergenic
993443217 5:87980670-87980692 GCACAGCTGCACCATGATCTTGG + Intergenic
996923550 5:128796767-128796789 GCACAGGTGGAGAAGGGTTTAGG - Intronic
997645607 5:135479552-135479574 GCACATCAGAACAAAGGGCTGGG - Intergenic
998677031 5:144421070-144421092 TAACAGCTGGGAAAAGGTCTGGG - Intronic
998875702 5:146596865-146596887 GCAGGGCTGGAGAAAGGTTTGGG - Intronic
1003164345 6:3663288-3663310 CCACATCTGGACAAAGGCCAAGG + Intergenic
1003241666 6:4350607-4350629 GCACACCTGGACAAGGGTGGTGG + Intergenic
1003729103 6:8800634-8800656 GGAAAGCTAGACAAAGGTATAGG + Intergenic
1004935661 6:20505811-20505833 AAACAGCTGGACAAAGGGCCTGG - Intergenic
1004969025 6:20888163-20888185 GAACACCTGGACACAGGGCTGGG - Intronic
1005813055 6:29530853-29530875 CCACAGCTGGAGGAAGGCCTGGG - Intergenic
1007170073 6:39856526-39856548 GCAGAGCTGGACAGAGGGCAGGG + Intronic
1007505677 6:42333548-42333570 GCGCAGCTGGAGAAAGGCTTGGG + Intronic
1008535225 6:52502324-52502346 GGACTGCTGGAGAAAGGCCTAGG + Exonic
1018961527 6:168452843-168452865 GCAGAGCAGGACAAAAGCCTCGG - Intronic
1019530321 7:1499878-1499900 GCTCACCTTGACAAAGATCTCGG + Exonic
1021595743 7:22314821-22314843 GTACAGCTGGACCAAGGGCATGG - Intronic
1022864457 7:34403042-34403064 GCAAAACTGGAAAAAGGTGTAGG - Intergenic
1025299541 7:57807130-57807152 GCAGAGCTGGAGTAAGGACTTGG - Intergenic
1026455517 7:70569083-70569105 GAACAGCTGCACAAAGTACTTGG - Intronic
1029598592 7:101550715-101550737 GGACAGCTGGACACGGGCCTGGG + Intronic
1030796221 7:113791192-113791214 GAACAAATGGACATAGGTCTTGG - Intergenic
1031366519 7:120906650-120906672 GAACACCTGGACACAGGTCGGGG + Intergenic
1035538819 8:415608-415630 GCACAGCTGGACAGAGGGTCAGG + Intronic
1039706625 8:40014049-40014071 GGCCAGCTGGAAACAGGTCTGGG + Intronic
1040896709 8:52375715-52375737 GGAGTGCTGGAGAAAGGTCTTGG - Intronic
1044091290 8:88005216-88005238 GCTCAGCTGGACAAGGCTATTGG - Intergenic
1047982953 8:130202327-130202349 GGAAAGATGGACAAAGGTATAGG - Intronic
1049045055 8:140143231-140143253 GCACAGCTGGGCAGAAGTCTGGG + Intronic
1049509631 8:143021011-143021033 GCACAGCTGGACAAAGGTCTGGG - Intronic
1049968910 9:804168-804190 GCAGGCCTGGACAAAGGTGTGGG - Intergenic
1051366673 9:16326171-16326193 GCACAGCTGGGCAATGGTAGAGG - Intergenic
1051535967 9:18158123-18158145 GCAGAGCTGGCCAGAGGTTTGGG + Intergenic
1057824824 9:98364359-98364381 GAATAGCTGGACAAATGCCTGGG - Intronic
1059244298 9:112836589-112836611 ACACAGCAGGACAAAGGACGGGG - Intronic
1060758614 9:126230163-126230185 GAGCAGCTGGACCAAGATCTTGG - Intergenic
1061250299 9:129422558-129422580 CCACAGCAGCACAAAGGTCGGGG - Intergenic
1061640810 9:131953638-131953660 GAACAGCTGGCCAAAGGTTATGG + Intronic
1062688239 9:137827455-137827477 GCTCAGGTGGACAGGGGTCTGGG - Intronic
1186524547 X:10236427-10236449 GGACAGGTGGACTAAGGTCAAGG + Exonic
1189255908 X:39638938-39638960 GCATAGCTGGATAAAGATTTTGG - Intergenic
1193469014 X:81876652-81876674 GCTCAGCTGCACAAGGGTCAGGG + Intergenic
1201738340 Y:17296107-17296129 ACACAGCTTGACAAAGGTTGGGG - Intergenic