ID: 1049512509

View in Genome Browser
Species Human (GRCh38)
Location 8:143036325-143036347
Sequence CAGCTGGACGGGAGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049512494_1049512509 27 Left 1049512494 8:143036275-143036297 CCCGGCTACTTGGGAGGCTGAGA 0: 103
1: 7877
2: 111355
3: 220034
4: 255864
Right 1049512509 8:143036325-143036347 CAGCTGGACGGGAGGGCAGCTGG No data
1049512495_1049512509 26 Left 1049512495 8:143036276-143036298 CCGGCTACTTGGGAGGCTGAGAC 0: 4912
1: 94001
2: 203927
3: 240558
4: 231711
Right 1049512509 8:143036325-143036347 CAGCTGGACGGGAGGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049512509 Original CRISPR CAGCTGGACGGGAGGGCAGC TGG Intergenic
No off target data available for this crispr