ID: 1049513867

View in Genome Browser
Species Human (GRCh38)
Location 8:143043438-143043460
Sequence TCCTGATGGCTTTGATGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 209}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049513867_1049513875 8 Left 1049513867 8:143043438-143043460 CCTGAACATCAAAGCCATCAGGA 0: 1
1: 0
2: 0
3: 19
4: 209
Right 1049513875 8:143043469-143043491 ATCGGAGCCCTTTCACTTAGGGG No data
1049513867_1049513869 -10 Left 1049513867 8:143043438-143043460 CCTGAACATCAAAGCCATCAGGA 0: 1
1: 0
2: 0
3: 19
4: 209
Right 1049513869 8:143043451-143043473 GCCATCAGGACCAAGGCCATCGG 0: 1
1: 0
2: 4
3: 16
4: 140
1049513867_1049513880 27 Left 1049513867 8:143043438-143043460 CCTGAACATCAAAGCCATCAGGA 0: 1
1: 0
2: 0
3: 19
4: 209
Right 1049513880 8:143043488-143043510 GGGGACGCTGAGGCCACCCAGGG No data
1049513867_1049513878 17 Left 1049513867 8:143043438-143043460 CCTGAACATCAAAGCCATCAGGA 0: 1
1: 0
2: 0
3: 19
4: 209
Right 1049513878 8:143043478-143043500 CTTTCACTTAGGGGACGCTGAGG No data
1049513867_1049513873 6 Left 1049513867 8:143043438-143043460 CCTGAACATCAAAGCCATCAGGA 0: 1
1: 0
2: 0
3: 19
4: 209
Right 1049513873 8:143043467-143043489 CCATCGGAGCCCTTTCACTTAGG No data
1049513867_1049513879 26 Left 1049513867 8:143043438-143043460 CCTGAACATCAAAGCCATCAGGA 0: 1
1: 0
2: 0
3: 19
4: 209
Right 1049513879 8:143043487-143043509 AGGGGACGCTGAGGCCACCCAGG No data
1049513867_1049513874 7 Left 1049513867 8:143043438-143043460 CCTGAACATCAAAGCCATCAGGA 0: 1
1: 0
2: 0
3: 19
4: 209
Right 1049513874 8:143043468-143043490 CATCGGAGCCCTTTCACTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049513867 Original CRISPR TCCTGATGGCTTTGATGTTC AGG (reversed) Intronic