ID: 1049515085

View in Genome Browser
Species Human (GRCh38)
Location 8:143050092-143050114
Sequence TGGACTCTGCGCCCTGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049515082_1049515085 -8 Left 1049515082 8:143050077-143050099 CCTTTCCAAAGCAGCTGGACTCT 0: 1
1: 0
2: 0
3: 21
4: 168
Right 1049515085 8:143050092-143050114 TGGACTCTGCGCCCTGCAGGTGG No data
1049515078_1049515085 26 Left 1049515078 8:143050043-143050065 CCGGTTGTGGGAGAAACGTCTCA 0: 1
1: 0
2: 0
3: 9
4: 56
Right 1049515085 8:143050092-143050114 TGGACTCTGCGCCCTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049515085 Original CRISPR TGGACTCTGCGCCCTGCAGG TGG Intronic
No off target data available for this crispr