ID: 1049517604

View in Genome Browser
Species Human (GRCh38)
Location 8:143069693-143069715
Sequence CAGAGCAACCACTTCAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049517604_1049517608 13 Left 1049517604 8:143069693-143069715 CCACATTTGAAGTGGTTGCTCTG No data
Right 1049517608 8:143069729-143069751 CTACTTCCTTTCACTAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049517604 Original CRISPR CAGAGCAACCACTTCAAATG TGG (reversed) Intergenic
No off target data available for this crispr