ID: 1049519592

View in Genome Browser
Species Human (GRCh38)
Location 8:143081087-143081109
Sequence CCGCTGGCTGTGGCGTCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049519583_1049519592 -4 Left 1049519583 8:143081068-143081090 CCTAACCCTGTGCACCCTCCCGC 0: 1
1: 0
2: 1
3: 20
4: 246
Right 1049519592 8:143081087-143081109 CCGCTGGCTGTGGCGTCTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 177
1049519585_1049519592 -9 Left 1049519585 8:143081073-143081095 CCCTGTGCACCCTCCCGCTGGCT 0: 1
1: 0
2: 2
3: 19
4: 182
Right 1049519592 8:143081087-143081109 CCGCTGGCTGTGGCGTCTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 177
1049519586_1049519592 -10 Left 1049519586 8:143081074-143081096 CCTGTGCACCCTCCCGCTGGCTG 0: 1
1: 0
2: 2
3: 14
4: 194
Right 1049519592 8:143081087-143081109 CCGCTGGCTGTGGCGTCTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 177
1049519582_1049519592 22 Left 1049519582 8:143081042-143081064 CCTTCTGGCGTCATGGAGAGGCT 0: 1
1: 0
2: 1
3: 7
4: 176
Right 1049519592 8:143081087-143081109 CCGCTGGCTGTGGCGTCTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049519592 Original CRISPR CCGCTGGCTGTGGCGTCTGC TGG Exonic
900596023 1:3480548-3480570 CCGCAGGATGGAGCGTCTGCGGG + Exonic
900623524 1:3598075-3598097 TGGCTGGCTGTGGGGTCTGCAGG - Intronic
900801430 1:4739299-4739321 CGGCAGGCTTTGGGGTCTGCCGG + Intronic
901514744 1:9737497-9737519 CCTGTGACTGTGGCCTCTGCAGG - Exonic
902536586 1:17122305-17122327 CCACTGGGTGTGGGGTCTCCGGG + Intergenic
903377772 1:22877145-22877167 CCACTGGCTGTGGCTGATGCCGG - Intronic
903435293 1:23344512-23344534 CCCCTGGCTGGGGCGCCTCCGGG + Intergenic
904261528 1:29290431-29290453 CGGCAGGCTGTGGAGTCAGCAGG - Intronic
904292909 1:29499149-29499171 CGGCAGGCTGTGGAGTCAGCAGG + Intergenic
904412355 1:30332113-30332135 CGGCAGGCTGTGGAGTCAGCAGG - Intergenic
905023190 1:34831993-34832015 CCTCTGGCTGTGGAGGCAGCTGG - Intronic
905107547 1:35573479-35573501 CCGCGGGCTGTGCCGGCTCCCGG + Exonic
905410506 1:37765135-37765157 CCGCTGGCTCTGGGGTCTGGGGG - Intergenic
909058223 1:70847330-70847352 CAGCTGGCTGAGGGGGCTGCTGG - Intergenic
910597270 1:88993048-88993070 CCATTGGCTGTGGAGTCGGCCGG + Intergenic
914754678 1:150556202-150556224 CTGATGGCTGTGGAGTCTGTGGG + Exonic
915272045 1:154760501-154760523 CCTCTCGCTGTGGCGACAGCCGG - Intronic
915559152 1:156676499-156676521 CCGCTGGCAGGAGCGGCTGCGGG - Exonic
919920902 1:202165899-202165921 CCCCTGGCTGTGGCCTGAGCAGG + Intergenic
920965690 1:210698880-210698902 CAGCTGCCCGTGGCCTCTGCAGG - Intronic
1068120875 10:52780901-52780923 CAGGTGGCTCTGGGGTCTGCTGG + Intergenic
1069836589 10:71313066-71313088 CCCATGGCTGTGGCCTCGGCTGG - Intergenic
1070662759 10:78319448-78319470 CCGCTGGATGTGGAAACTGCAGG - Intergenic
1072169919 10:92848872-92848894 CCGGTGGGTGTGGCTGCTGCAGG + Intronic
1074881262 10:117661325-117661347 CTGTGGGCTGTGGCGGCTGCAGG + Intergenic
1075835886 10:125452414-125452436 CAGCTGGCTTTGGCTCCTGCAGG - Intergenic
1076706881 10:132307299-132307321 CCCGCGGCTGTGGCGTCTCCGGG - Intronic
1077042776 11:531914-531936 CCGGTGGCTCTGGTCTCTGCTGG - Intergenic
1083528587 11:63396164-63396186 TCTCTGCCTGTGGAGTCTGCAGG + Intronic
1084210441 11:67619118-67619140 CGGCTGGCTGCGGCGAGTGCGGG - Intergenic
1085176617 11:74493610-74493632 CCGCTGGCTGCGGCGGCTGCAGG - Exonic
1085325765 11:75605547-75605569 CCGCTGGCTGTGCCCTCCCCTGG - Intronic
1085858315 11:80201519-80201541 CCGCTGGTTGTGGAGTCAGATGG + Intergenic
1086960886 11:92979347-92979369 CCGCTGGCTGTCTCCACTGCTGG - Intronic
1088598197 11:111455334-111455356 CTGGTGGCTGTAGCGCCTGCAGG + Intronic
1091357595 11:134949547-134949569 CTGCTGGCTGGGACCTCTGCTGG + Intergenic
1092413949 12:8275345-8275367 CAGCTGGCGGTGGGCTCTGCTGG + Intergenic
1095206206 12:39443051-39443073 CAGTAGGCTGGGGCGTCTGCGGG + Intronic
1096083913 12:48852287-48852309 CCCCAGGCTGCGGGGTCTGCCGG + Intronic
1096782699 12:54000291-54000313 CCGCTGGGTCTGGCGGCGGCGGG - Exonic
1096888658 12:54743949-54743971 CCTCTGCCTGTGGAGTCTGCAGG + Intergenic
1098833002 12:75386403-75386425 CTGCTGGCTGTGTCATCTGATGG + Intronic
1100962856 12:99983676-99983698 CCGAAGGCTGTGGCTTTTGCAGG + Intronic
1101039888 12:100744686-100744708 CAGCTGGCTGTGGAGGCTGATGG - Intronic
1101491232 12:105211651-105211673 CAGCTGGCTGTGTTCTCTGCAGG - Intronic
1102975961 12:117207427-117207449 CCCTTGGGTGTGGCTTCTGCTGG + Intergenic
1106558193 13:30827990-30828012 CCACTGGCTTTGGCTTCGGCCGG + Intergenic
1107184773 13:37505539-37505561 CCTCTGCCTGTGAAGTCTGCAGG - Intergenic
1108485496 13:50919474-50919496 CCCCTGGCTGTGTGGTCTACTGG + Intronic
1115770910 14:36663330-36663352 GCGCTGGCTGCGGCGTCGGCTGG - Exonic
1117548594 14:56812198-56812220 CCGCTGGCTGTCGCGTTCCCAGG + Intergenic
1118316087 14:64726962-64726984 CCCCTGTCTGTGGCCTGTGCTGG - Intronic
1119756755 14:77125138-77125160 CCGCGGGCTCTGGCGGGTGCCGG + Intronic
1121435165 14:93914503-93914525 CTGCTGGCTGTGGCCTGAGCTGG - Intergenic
1122016812 14:98803427-98803449 GCCCTGGCCGTGGCGTCAGCCGG + Intergenic
1127062377 15:55200248-55200270 CTGCTGGCTGTTTGGTCTGCTGG + Intergenic
1128578974 15:68795673-68795695 CCGCAGGCTGGGGTGGCTGCAGG + Intronic
1129702194 15:77774430-77774452 CCGCTGCTTGTGGTGTCTGGGGG - Intronic
1131213771 15:90520036-90520058 CTGCTGGCTGTTGCTTCTGGTGG - Intergenic
1132184530 15:99792013-99792035 CCGCTGCCTCTGGCTTCTGCTGG - Intergenic
1132432447 15:101772646-101772668 CCGCTGCCTCTGGCTTCTTCTGG + Intergenic
1134206570 16:12243011-12243033 CCCCTGGCTGTGGAGGCTCCTGG + Intronic
1135899558 16:26444347-26444369 CCGATGGCTGAGGCCTATGCAGG + Intergenic
1136637784 16:31536970-31536992 CCTCTGGCTGTGGCCTTTCCAGG + Intergenic
1138340330 16:56284999-56285021 GTGCTGGCTGGGGCCTCTGCAGG - Intronic
1141840122 16:86568559-86568581 CCCCGGGCTGCGGCGTCGGCTGG - Exonic
1142218215 16:88840267-88840289 CGGCTGCCTGTGGCTCCTGCCGG - Intronic
1143364091 17:6394376-6394398 TCTCTGCCTGTGGCATCTGCAGG + Intronic
1146064272 17:29622647-29622669 CCGCTGGCTGCGGTGACGGCCGG + Intronic
1147727603 17:42576265-42576287 AGGCTGGCTGGGGCGTCTTCCGG + Intronic
1148048873 17:44759560-44759582 CCGCGGGCTCTTGCCTCTGCAGG + Intronic
1148218324 17:45845941-45845963 CCGCTGGGCGTGGCTCCTGCAGG + Exonic
1149363132 17:55914484-55914506 CTGCTGGCTGAAGTGTCTGCGGG + Intergenic
1149664250 17:58354670-58354692 CTGCTGCCTGTGGCGTGTGTGGG - Exonic
1149678504 17:58487746-58487768 CCGCGGGCGGCGGCGGCTGCTGG + Exonic
1150724190 17:67638192-67638214 GCACTGCCTGTGGCCTCTGCAGG - Intronic
1151373572 17:73666642-73666664 GGGCTGTCTGTGGCCTCTGCTGG + Intergenic
1151408105 17:73902481-73902503 CCGCTGGCTTTGGCCTGGGCAGG + Intergenic
1151472262 17:74325855-74325877 CCGCTGTCTCTGGGGTCTCCAGG - Intergenic
1151802778 17:76387553-76387575 CTTCTGGCGGTGGCATCTGCTGG - Exonic
1152374600 17:79912701-79912723 CCGCTGCCTCTGCCCTCTGCTGG - Intergenic
1152697359 17:81803859-81803881 CCGCGGGCTCAGGGGTCTGCAGG + Intergenic
1152811660 17:82385467-82385489 TAGCTGGCAGTGGGGTCTGCAGG - Intergenic
1152945987 17:83197502-83197524 CAGCTGGGTGTGGGATCTGCAGG + Intergenic
1154497315 18:14971607-14971629 CTGCTGGCTGGGACCTCTGCTGG - Intergenic
1157617503 18:48995902-48995924 CCTCTGGCTGGGGTGTTTGCTGG - Intergenic
1158540304 18:58347411-58347433 CCGCTGGTTGTGGCGTTACCTGG + Intronic
1158677357 18:59532486-59532508 CCGCTGGCTGTGAAGGCTACTGG + Intronic
1159977949 18:74739288-74739310 CCTCTGGCAGTGGCTTCTGTGGG - Intronic
1160177881 18:76611030-76611052 CCGCTGGCTGTGGCGGCAGGCGG + Intergenic
1160463538 18:79057212-79057234 CGGCTGGCTGTGGACTCAGCAGG + Intergenic
1161563871 19:4988739-4988761 CCCCGGGCTGTGACGTCTCCAGG + Intronic
1162499208 19:11041871-11041893 CCGCCTGCTGTGGCCTCTGCTGG - Intronic
1163519061 19:17781245-17781267 TCCCTGGCTGTGGGGTCAGCAGG - Exonic
1166989451 19:46682482-46682504 TCCCTGGCTGGGGTGTCTGCAGG - Intronic
1168071276 19:53953384-53953406 CGGCTGGCTGTGTCCTCTGCTGG + Intergenic
925752089 2:7097789-7097811 CCACTGGCTGTGATGCCTGCTGG - Intergenic
928309136 2:30195206-30195228 TCGCTGGCTGTGGCCTGGGCAGG - Intergenic
930701117 2:54457767-54457789 CTGCTGGATGTGGCGTCAGGAGG + Intronic
932790144 2:74648128-74648150 GCGCTGGCCGTGGCGGGTGCCGG - Intronic
933040470 2:77458582-77458604 CCGTTGGCTCTGGCTTCTACTGG + Intronic
938061890 2:128261305-128261327 TCCATGGCTGTGGCCTCTGCTGG + Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
942502717 2:176608160-176608182 CCTTTGGATGTGGAGTCTGCTGG + Intergenic
944412675 2:199458620-199458642 TCGCTGGGTGCCGCGTCTGCCGG + Intronic
945095792 2:206217822-206217844 CCGGTGCCTGTGGCTGCTGCGGG + Exonic
947715066 2:232335203-232335225 CAGCTGGCCCTGGGGTCTGCAGG + Intronic
947734141 2:232446154-232446176 CAGCTGGCCCTGGGGTCTGCAGG + Intergenic
948664865 2:239528511-239528533 ACGCTGGATGTGAAGTCTGCTGG - Intergenic
948806221 2:240454379-240454401 CCGGTGGCTGTGGCATCCTCCGG - Intronic
1170985159 20:21251303-21251325 CCGCAGGCTGTGGTTTCTGGAGG - Intergenic
1171968322 20:31547354-31547376 GCGCTGGCTGTGTCATCTTCCGG + Intronic
1172628589 20:36363268-36363290 GGGCTGCCTGTGGCGTCTGCAGG + Intronic
1174379381 20:50146874-50146896 CCCCAGGCTGGGGCGGCTGCTGG - Intronic
1175998526 20:62821861-62821883 CCCCTGGCTGTTGAGTCTGGGGG - Intronic
1176029520 20:63005267-63005289 CCGCTGCCTGGGACGTCCGCGGG - Intergenic
1177995404 21:28090248-28090270 CCCCTGCCTGTGAAGTCTGCAGG + Intergenic
1183307338 22:37089690-37089712 CAGCTGCCTGTGGCACCTGCAGG - Exonic
1183329700 22:37212610-37212632 CCGCTGGCCTTGGCTCCTGCAGG + Intergenic
1183880004 22:40819283-40819305 CCACTGGCTGCGGCATCTGTGGG - Exonic
949984940 3:9533142-9533164 CTGCTTGCTGTAGCATCTGCTGG + Intronic
950197435 3:11018725-11018747 GCTCTGGGTGTGGCTTCTGCTGG - Intronic
954106480 3:48412364-48412386 CCTCGGGCTGGGGGGTCTGCAGG - Intronic
955239299 3:57165201-57165223 CAGCTGGCTGTGGCCGCTGGCGG - Exonic
961568701 3:127783231-127783253 CCGCTGGCTGTCTGGTCTCCAGG + Intronic
961891492 3:130133960-130133982 CAGCTGGCGGTGGGCTCTGCTGG + Intergenic
965282328 3:166770022-166770044 CTTCTGGCTGTGGAGTGTGCAGG + Intergenic
966945017 3:184771583-184771605 CCGGTGGCTGTGGTGGCTGACGG + Intergenic
967019172 3:185507487-185507509 CCCATGGCTGTGGCCACTGCAGG - Exonic
968307225 3:197658105-197658127 TCGCTGTCTGTGGAGGCTGCAGG + Intergenic
968701031 4:2058573-2058595 CCCCAGCCTGCGGCGTCTGCAGG + Intergenic
968728561 4:2259390-2259412 CATATGGCTGTGGCCTCTGCTGG - Intronic
968729953 4:2264925-2264947 CCGCAGGGTGTGGCATCTCCAGG + Intergenic
968845987 4:3041802-3041824 GCGCTGGCTGCGGCTTCCGCAGG + Intergenic
969508881 4:7605844-7605866 CCACTGGCTGCAGCCTCTGCTGG - Intronic
969534275 4:7746334-7746356 CCCCAGGCTGTGCAGTCTGCAGG - Intergenic
969539494 4:7778066-7778088 CGGCTGGATGTGGAGTCTGAAGG + Intronic
969704873 4:8786201-8786223 CGACCGGCAGTGGCGTCTGCTGG - Intergenic
981760848 4:148192938-148192960 CCCCTGCCTGTGAAGTCTGCAGG + Intronic
985544868 5:504526-504548 CCGCTTGCTGTGTGGTCTGAAGG - Intronic
985546623 5:513180-513202 CCCCTGGCTTTGTGGTCTGCTGG - Intronic
985678194 5:1243064-1243086 CTGCTGGGTGCAGCGTCTGCTGG - Intronic
992104304 5:73437181-73437203 CCGCCGGCTGTGGCGAGCGCAGG - Intergenic
1001996172 5:176161015-176161037 ACGCTGGCTGTGGCTACTGTGGG - Intergenic
1002843756 6:927491-927513 CCGCTGGCTGGAGAGACTGCAGG + Intergenic
1007163661 6:39812637-39812659 CCTCTGACTGTGGAGTCAGCAGG + Intronic
1007776603 6:44227506-44227528 GTGCTGGCTGGGGTGTCTGCGGG + Intronic
1014272401 6:119349272-119349294 CCGCTGGCTGCAGCCCCTGCGGG + Exonic
1019779339 7:2930290-2930312 CCACTCTCTGTGGCATCTGCTGG + Intronic
1023418283 7:39951333-39951355 GCTGTGGCTGTGGCGGCTGCGGG - Exonic
1024955155 7:54910631-54910653 CAGCTAGCTGAGGGGTCTGCTGG - Intergenic
1025739198 7:64182627-64182649 CTGCTGGCTGAGGCCTGTGCCGG + Intronic
1033154710 7:138946981-138947003 CCGTTGGCAGTGGGGGCTGCTGG - Intronic
1033979754 7:147149037-147149059 CTGCTGGCTGGGGTGGCTGCTGG + Intronic
1034617902 7:152435478-152435500 CCGCGGGCGGTGGCGGCTCCCGG - Intronic
1034676734 7:152897581-152897603 CCTCTGGCTGTGGAGCCTGTTGG - Intergenic
1034994560 7:155569925-155569947 CCGCTGGCCCTGGCCTCGGCTGG - Intergenic
1035132963 7:156672971-156672993 CCGCGGACTGTGGCCTCGGCAGG + Intronic
1035305360 7:157928325-157928347 CTGCTGGCTGTGGGATCTCCAGG - Intronic
1035819843 8:2579620-2579642 CTGATGCCTGTGGGGTCTGCAGG - Intergenic
1036374340 8:8187531-8187553 CAGCTGGCGGTGGGCTCTGCTGG - Intergenic
1037803594 8:22048086-22048108 GCGCTGGTTCTGGCGGCTGCGGG - Exonic
1039542334 8:38382325-38382347 CCGCGGGCCGCGGCGCCTGCCGG + Intergenic
1040415138 8:47188870-47188892 CCGGTGGCCGTGGCGGCTCCTGG - Intergenic
1040979604 8:53232690-53232712 CAGAGGGCTGTGGCTTCTGCTGG + Intronic
1042166440 8:65950462-65950484 CCCCTGGGTGTGGCGGCTGCGGG + Intergenic
1045249282 8:100469781-100469803 CCGCAGGCTCTGGTGTCAGCTGG - Intergenic
1046654213 8:116874723-116874745 GCGCCGGCTGTGGCGGCGGCGGG - Exonic
1047225812 8:122954705-122954727 CCGCTGGCTGTGGCCTGTTTGGG + Intronic
1047732105 8:127736379-127736401 CCGCTGGCTGGGGGATCAGCGGG - Exonic
1049472606 8:142783100-142783122 CCCCTTGCTGGGGCATCTGCCGG - Intergenic
1049472907 8:142784206-142784228 CCCCTTGCTGGGGCATCTGCCGG + Intergenic
1049519592 8:143081087-143081109 CCGCTGGCTGTGGCGTCTGCTGG + Exonic
1049608468 8:143541068-143541090 CCGCGGGCTGTCGCGTCCCCCGG - Intronic
1049762328 8:144337048-144337070 CCGCAGGCAGAGGCGGCTGCGGG - Intergenic
1053435223 9:38069442-38069464 CCGCGGGAGGTGGCGTGTGCAGG - Intergenic
1056143582 9:83707744-83707766 CTGCCGGCTCTGGTGTCTGCTGG - Exonic
1057489302 9:95508970-95508992 CTGCTGGCGGTGGCGGCTCCAGG + Intronic
1059447475 9:114347742-114347764 CAGGTGGCTGGGGAGTCTGCTGG + Exonic
1061799922 9:133108218-133108240 CAGCTGGCTCTGGAGCCTGCTGG + Exonic
1061860704 9:133467348-133467370 CTGCAGGCTGCGGGGTCTGCGGG - Intronic
1062269378 9:135701688-135701710 CCGCAGGCTGCGGCATCTGTGGG - Intergenic
1062461186 9:136663174-136663196 CCGCTGACCGTGGCGCCTGCTGG + Intronic
1062683394 9:137797207-137797229 CAGCTAGCTGTGAGGTCTGCAGG - Intronic
1062702952 9:137917586-137917608 CCCTTGGGTGGGGCGTCTGCCGG - Intronic
1203365184 Un_KI270442v1:249769-249791 CCGCTGGCCGAGGCGGCTGTGGG - Intergenic
1186404893 X:9293125-9293147 CCGCCGGCTGTTTGGTCTGCCGG - Intergenic
1189280778 X:39818988-39819010 CCTCTGGCTGTGGCACCTTCGGG - Intergenic
1190061709 X:47215763-47215785 CAGCTGGCTGTGGGGACTGAGGG + Intergenic
1196840228 X:119852852-119852874 CCGCTGCCTGTGGCCCCGGCGGG + Exonic