ID: 1049521362

View in Genome Browser
Species Human (GRCh38)
Location 8:143092976-143092998
Sequence CTGGATCCCTTAGGAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049521350_1049521362 23 Left 1049521350 8:143092930-143092952 CCTTCATCCTCCTCGTGGACTCA No data
Right 1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG No data
1049521345_1049521362 29 Left 1049521345 8:143092924-143092946 CCCCTCCCTTCATCCTCCTCGTG No data
Right 1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG No data
1049521353_1049521362 16 Left 1049521353 8:143092937-143092959 CCTCCTCGTGGACTCAGCTGGGG No data
Right 1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG No data
1049521348_1049521362 27 Left 1049521348 8:143092926-143092948 CCTCCCTTCATCCTCCTCGTGGA No data
Right 1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG No data
1049521349_1049521362 24 Left 1049521349 8:143092929-143092951 CCCTTCATCCTCCTCGTGGACTC No data
Right 1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG No data
1049521359_1049521362 -10 Left 1049521359 8:143092963-143092985 CCATGCTGGGCCTCTGGATCCCT No data
Right 1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG No data
1049521346_1049521362 28 Left 1049521346 8:143092925-143092947 CCCTCCCTTCATCCTCCTCGTGG No data
Right 1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG No data
1049521355_1049521362 13 Left 1049521355 8:143092940-143092962 CCTCGTGGACTCAGCTGGGGACT No data
Right 1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049521362 Original CRISPR CTGGATCCCTTAGGAAAAGC AGG Intergenic
No off target data available for this crispr