ID: 1049521903

View in Genome Browser
Species Human (GRCh38)
Location 8:143095611-143095633
Sequence GCAGGAGAAAGCTGGGGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049521903_1049521912 21 Left 1049521903 8:143095611-143095633 CCTCGCCCCCAGCTTTCTCCTGC No data
Right 1049521912 8:143095655-143095677 TCCCCCATTGCCTTCCGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049521903 Original CRISPR GCAGGAGAAAGCTGGGGGCG AGG (reversed) Intergenic