ID: 1049526575

View in Genome Browser
Species Human (GRCh38)
Location 8:143129865-143129887
Sequence TGCCCAAGCACTAAAGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049526566_1049526575 3 Left 1049526566 8:143129839-143129861 CCTGAGCCAGTGGTCCCAGGACC No data
Right 1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG No data
1049526561_1049526575 28 Left 1049526561 8:143129814-143129836 CCTCCCAAAGGTTTCTCTTCTTC No data
Right 1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG No data
1049526563_1049526575 24 Left 1049526563 8:143129818-143129840 CCAAAGGTTTCTCTTCTTCTGCC No data
Right 1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG No data
1049526567_1049526575 -3 Left 1049526567 8:143129845-143129867 CCAGTGGTCCCAGGACCCCATGC No data
Right 1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG No data
1049526562_1049526575 25 Left 1049526562 8:143129817-143129839 CCCAAAGGTTTCTCTTCTTCTGC No data
Right 1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049526575 Original CRISPR TGCCCAAGCACTAAAGTGGG CGG Intergenic
No off target data available for this crispr