ID: 1049528318

View in Genome Browser
Species Human (GRCh38)
Location 8:143140865-143140887
Sequence CCGGTGTGGACGGAGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049528307_1049528318 13 Left 1049528307 8:143140829-143140851 CCAATCGGGACATACATTCAGGT No data
Right 1049528318 8:143140865-143140887 CCGGTGTGGACGGAGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049528318 Original CRISPR CCGGTGTGGACGGAGAACAA AGG Intergenic
No off target data available for this crispr