ID: 1049530657

View in Genome Browser
Species Human (GRCh38)
Location 8:143153230-143153252
Sequence TCTGCCGGGGAGGCACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049530649_1049530657 11 Left 1049530649 8:143153196-143153218 CCCAGGCCCTAGGGTGTAGCTAT No data
Right 1049530657 8:143153230-143153252 TCTGCCGGGGAGGCACATCCAGG No data
1049530651_1049530657 5 Left 1049530651 8:143153202-143153224 CCCTAGGGTGTAGCTATGTGACT No data
Right 1049530657 8:143153230-143153252 TCTGCCGGGGAGGCACATCCAGG No data
1049530650_1049530657 10 Left 1049530650 8:143153197-143153219 CCAGGCCCTAGGGTGTAGCTATG No data
Right 1049530657 8:143153230-143153252 TCTGCCGGGGAGGCACATCCAGG No data
1049530648_1049530657 14 Left 1049530648 8:143153193-143153215 CCTCCCAGGCCCTAGGGTGTAGC No data
Right 1049530657 8:143153230-143153252 TCTGCCGGGGAGGCACATCCAGG No data
1049530652_1049530657 4 Left 1049530652 8:143153203-143153225 CCTAGGGTGTAGCTATGTGACTT No data
Right 1049530657 8:143153230-143153252 TCTGCCGGGGAGGCACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049530657 Original CRISPR TCTGCCGGGGAGGCACATCC AGG Intergenic
No off target data available for this crispr