ID: 1049531370

View in Genome Browser
Species Human (GRCh38)
Location 8:143157184-143157206
Sequence AACTCAGGGCCAGGAGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049531358_1049531370 9 Left 1049531358 8:143157152-143157174 CCCCTGGCCACAGGGAGTGGCCT No data
Right 1049531370 8:143157184-143157206 AACTCAGGGCCAGGAGTGGCCGG No data
1049531356_1049531370 15 Left 1049531356 8:143157146-143157168 CCTCAACCCCTGGCCACAGGGAG No data
Right 1049531370 8:143157184-143157206 AACTCAGGGCCAGGAGTGGCCGG No data
1049531360_1049531370 7 Left 1049531360 8:143157154-143157176 CCTGGCCACAGGGAGTGGCCTCA No data
Right 1049531370 8:143157184-143157206 AACTCAGGGCCAGGAGTGGCCGG No data
1049531359_1049531370 8 Left 1049531359 8:143157153-143157175 CCCTGGCCACAGGGAGTGGCCTC No data
Right 1049531370 8:143157184-143157206 AACTCAGGGCCAGGAGTGGCCGG No data
1049531362_1049531370 2 Left 1049531362 8:143157159-143157181 CCACAGGGAGTGGCCTCAGGAGC No data
Right 1049531370 8:143157184-143157206 AACTCAGGGCCAGGAGTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049531370 Original CRISPR AACTCAGGGCCAGGAGTGGC CGG Intergenic
No off target data available for this crispr