ID: 1049531866

View in Genome Browser
Species Human (GRCh38)
Location 8:143159145-143159167
Sequence GTGTGTGCACGCACGTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 14, 3: 51, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049531866_1049531868 -3 Left 1049531866 8:143159145-143159167 CCCATGCACGTGCGTGCACACAC 0: 1
1: 0
2: 14
3: 51
4: 300
Right 1049531868 8:143159165-143159187 CACACACACAAACACACACACGG No data
1049531866_1049531869 -2 Left 1049531866 8:143159145-143159167 CCCATGCACGTGCGTGCACACAC 0: 1
1: 0
2: 14
3: 51
4: 300
Right 1049531869 8:143159166-143159188 ACACACACAAACACACACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049531866 Original CRISPR GTGTGTGCACGCACGTGCAT GGG (reversed) Intronic