ID: 1049531866

View in Genome Browser
Species Human (GRCh38)
Location 8:143159145-143159167
Sequence GTGTGTGCACGCACGTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 14, 3: 51, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049531866_1049531868 -3 Left 1049531866 8:143159145-143159167 CCCATGCACGTGCGTGCACACAC 0: 1
1: 0
2: 14
3: 51
4: 300
Right 1049531868 8:143159165-143159187 CACACACACAAACACACACACGG 0: 18
1: 1889
2: 2175
3: 3142
4: 5905
1049531866_1049531869 -2 Left 1049531866 8:143159145-143159167 CCCATGCACGTGCGTGCACACAC 0: 1
1: 0
2: 14
3: 51
4: 300
Right 1049531869 8:143159166-143159188 ACACACACAAACACACACACGGG 0: 16
1: 1592
2: 2748
3: 4227
4: 7201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049531866 Original CRISPR GTGTGTGCACGCACGTGCAT GGG (reversed) Intronic
900101921 1:965642-965664 GTGGGTGCACACGCGTGCACTGG + Exonic
900353221 1:2247255-2247277 GTGTGTGCACAGGTGTGCATGGG + Intronic
900358752 1:2277844-2277866 GTGTGTGCACGTATGTCCGTCGG - Intronic
900464640 1:2819573-2819595 GTGTGTGCACACAGGTGTGTGGG - Intergenic
900544629 1:3221704-3221726 GTGTGTGCATGCGTGTACATGGG - Intronic
901664227 1:10817322-10817344 GTGAGTGCAGGCCAGTGCATTGG - Intergenic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
902786793 1:18738197-18738219 CAGGGTGCACGCATGTGCATGGG + Intronic
904499789 1:30907465-30907487 GCGTGTGCATGCAGGTGCATGGG - Intronic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905110348 1:35590238-35590260 ATGTGTGCATGCATGTGCAATGG + Intronic
905881947 1:41469773-41469795 GTGTGAGCACACATGCGCATAGG - Intergenic
907460166 1:54601147-54601169 GTGTGTGCATGCATGTGTGTGGG + Intronic
908214514 1:61937113-61937135 GTGTGTGCACCCATGCACATGGG - Intronic
909024622 1:70468165-70468187 GTGCATGCACACAGGTGCATTGG - Intergenic
912376606 1:109214370-109214392 GTGTGCGTACGCACGCGCATCGG + Intronic
912750861 1:112286224-112286246 GTGTTTGCATGCACGTGGAGTGG + Intergenic
915903299 1:159861573-159861595 GTGGGTGCGTGCACCTGCATGGG - Intronic
918995793 1:191757538-191757560 GTGTGTGCGCGCGCGTGGGTGGG - Intergenic
919399353 1:197091240-197091262 GTGTGTGCACACACATGCACAGG + Intronic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920297705 1:204969152-204969174 GTGTGTGCATGCCCGTGCATGGG + Intronic
922023165 1:221724721-221724743 GTGTGTGCATGCACATGGAGGGG + Intronic
922977882 1:229800344-229800366 GTGTGTGCCTGCACGGACATGGG + Intergenic
922997026 1:229972310-229972332 GTGTGTGCATGCACGCACACAGG - Intergenic
1063382103 10:5591895-5591917 GTGTGCGCGTGCACGTGCAGAGG - Intergenic
1064342286 10:14498332-14498354 GTGTGTTCATGCAAGTGCACGGG + Intergenic
1065667356 10:28076526-28076548 GTGTGTGCGCGCATGTGTGTGGG - Intronic
1067074205 10:43164434-43164456 GTGTGTGTGCACACATGCATGGG - Intronic
1067512499 10:46907602-46907624 GTGTGTGCACGCAGAGCCATGGG + Intergenic
1067649745 10:48144220-48144242 GTGTGTGCACGCAGAGCCATGGG - Intergenic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1069851596 10:71408961-71408983 GTGTGTGCATGTGCATGCATTGG + Intronic
1071953600 10:90732813-90732835 GTGTGTGCATGCACATGTATAGG + Intergenic
1072901047 10:99407203-99407225 GTGCATGCACGCACATGCCTTGG + Intronic
1073041934 10:100613629-100613651 GTGTGTGCACACATTTTCATGGG - Intergenic
1073082670 10:100869728-100869750 GTGTGTGCATGCATGTGTGTAGG + Intergenic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1074245485 10:111687049-111687071 GTGTGTGTGTGCACGTGCACAGG + Intergenic
1074730092 10:116362231-116362253 GTGTGTACACACATGTACATAGG + Intronic
1075831530 10:125416069-125416091 GTGTGTGCACACGTGTGTATGGG - Intergenic
1075927181 10:126261209-126261231 GTGTGTGCACAGTCGTGCCTTGG - Intronic
1076703831 10:132290491-132290513 GTGTATGCATGCACGCTCATAGG + Intronic
1076711302 10:132336320-132336342 GTGTGTGCCCCCACGTATATGGG - Intronic
1078065928 11:8079652-8079674 GTGTGTGCATGCATGTGTGTAGG + Intronic
1078930306 11:15907290-15907312 GTGTGTGCATGCTTGTGTATAGG - Intergenic
1081644459 11:44779974-44779996 GTGTGTGCAGGTATGTGCAAAGG - Intronic
1083736948 11:64686791-64686813 GTGTGTGCATGTATGTCCATAGG + Intronic
1083751904 11:64765670-64765692 GTGTGTGCACGCACTGGGCTGGG - Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1084925860 11:72510810-72510832 GTGTGTGGACTGATGTGCATTGG + Intergenic
1085738149 11:79057247-79057269 GTGTGTGCAGGCCAGTGCAGGGG - Intronic
1087072355 11:94093674-94093696 ATGTGTGCATGCACATGCTTGGG - Intronic
1089140440 11:116279905-116279927 GTGTGTGCGCGCACACACATAGG - Intergenic
1089153769 11:116385197-116385219 GTGTGTGCCTGCATGTGCATGGG - Intergenic
1089257109 11:117199837-117199859 GTGTGTGAACGCACCTGTGTTGG + Intronic
1089623782 11:119738359-119738381 GTGTGTGCATTCACATGCATAGG - Intergenic
1090270711 11:125384082-125384104 ATGTGTGCATGCGAGTGCATGGG - Intronic
1091154969 11:133363615-133363637 GTGCGAGAACACACGTGCATAGG - Intronic
1091299668 11:134499403-134499425 GTGTGTGCAAGAACCAGCATGGG - Intergenic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1098219830 12:68257469-68257491 GTGTGTGTGCACACGTGCGTGGG + Intergenic
1098342310 12:69465304-69465326 GTTTGTGAAACCACGTGCATAGG + Intergenic
1100719226 12:97339663-97339685 GTGTGTGCACGCACGTGTGCAGG + Intergenic
1102661762 12:114535075-114535097 GTGTGTACACGCATATGCACAGG + Intergenic
1103291671 12:119851278-119851300 GTGAGTGCACGCACATGTGTAGG + Intronic
1103910771 12:124350835-124350857 GTGTGGACACGCGTGTGCATCGG - Intronic
1104000373 12:124856395-124856417 GTGTTTGCACACACGTGTGTTGG - Intronic
1104371729 12:128229339-128229361 ATGTGTTCTCCCACGTGCATGGG + Intergenic
1105209311 13:18248323-18248345 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1106585746 13:31054880-31054902 GTGTGTGTATGCATGTGCACAGG - Intergenic
1106594862 13:31127353-31127375 GTGTGTGCATGCATATGCATGGG + Intergenic
1107625572 13:42279242-42279264 GGGTGTGCACGTGCGTGCACTGG - Intronic
1107934436 13:45333426-45333448 GTGTGTGCACACAGGTGGAGTGG - Intergenic
1108104687 13:46996484-46996506 GTGTGTGCACCCATGTGCAGAGG + Intergenic
1108166015 13:47693901-47693923 GTGCGTGCACACACATGCACAGG - Intergenic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1114924243 14:27374255-27374277 GTGTGTGTGCTCATGTGCATAGG + Intergenic
1118328643 14:64799121-64799143 GTGTGTGCATGCATGTTCATGGG + Intronic
1118693682 14:68363745-68363767 GTGTGTGCACACGCGTGTGTGGG + Intronic
1119350042 14:73956947-73956969 GTGTGTGCATGTACATGCATAGG + Intronic
1119723559 14:76908093-76908115 GTGTGTGCCCGCATGAGCGTTGG - Intergenic
1119853545 14:77883004-77883026 GTGTGTGCACACATGTGCGAAGG - Intronic
1121421258 14:93816893-93816915 GTGTGTGCAGGCACGCCCCTGGG - Intergenic
1121869305 14:97392626-97392648 GTGTGTGTGCACACATGCATGGG - Intergenic
1122043614 14:99007926-99007948 GTGTGTGCACGCACATGCAATGG - Intergenic
1122088232 14:99321486-99321508 GTGTGTGAGCGCATGTGTATAGG - Intergenic
1122544375 14:102514127-102514149 GTGTGTGCATGCGTGTGCGTGGG + Intergenic
1122940735 14:104980240-104980262 GTGTATGTATACACGTGCATGGG - Intergenic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1124635103 15:31360252-31360274 GTGTGGGCACGGACATGCAGCGG + Intronic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1128767424 15:70259697-70259719 GTGTGTGCCCGCATGTGCACGGG + Intergenic
1129426631 15:75468227-75468249 GTGTGTGCACTTATGTGTATGGG - Exonic
1129661484 15:77555349-77555371 GTGTGTGTGCACACGTGTATGGG + Intergenic
1129687151 15:77693061-77693083 GTGTGTGCACGCGTGCACATGGG - Intronic
1129707784 15:77804621-77804643 GTGTGTGCAAGGATGTGCAGGGG + Intronic
1130550399 15:84886869-84886891 GTGTGTGCACGCACATGCACGGG + Intronic
1130931237 15:88429553-88429575 GTGTGCGCATGCACATACATAGG - Intergenic
1131346147 15:91650321-91650343 GTGTGTGCACACATGTGCATGGG - Intergenic
1132124657 15:99212286-99212308 GTGTGTGCATGCATGTGCAATGG + Intronic
1132261971 15:100433708-100433730 GTGTGTGCACATGTGTGCATGGG - Intronic
1132392852 15:101451322-101451344 GTGTCTGCAGTCACGTCCATTGG - Intronic
1132565106 16:618597-618619 GTGTGTGCAGCCATGTGCACAGG + Intronic
1132565127 16:618720-618742 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565143 16:618841-618863 GTATGTGCAGGCATGTGCACAGG + Intronic
1132565162 16:618961-618983 GTGTGTGCAGGCATTTGCACAGG + Intronic
1132565178 16:619082-619104 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565198 16:619207-619229 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565217 16:619332-619354 GTGTGTGCAGCCATGTGCACAGG + Intronic
1133496789 16:6326030-6326052 GTGTGTACATGCATATGCATTGG + Intronic
1133511080 16:6457971-6457993 GCGTGTGCACACACATACATAGG + Intronic
1133924261 16:10181172-10181194 GTGTGTGCACGCGCGCGTGTAGG - Intronic
1135037738 16:19092171-19092193 GTGTGTGTGCGCGCGCGCATTGG + Intergenic
1135656415 16:24254374-24254396 GTGTATGCATGCACGTGTGTAGG - Intergenic
1137911526 16:52382901-52382923 GTGTGTGTGTGCACGTGCAAAGG - Intergenic
1141636063 16:85314513-85314535 ATGTGTGCACACACGTGTAGGGG - Intergenic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1142255109 16:89010087-89010109 GTGTGTGCAGGCTTGTGCATGGG - Intergenic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1143433991 17:6909134-6909156 GGGTGTGCACACATGTGCACTGG + Intronic
1144345907 17:14349473-14349495 GTGTGCGCATGCACGCACATGGG - Intergenic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1144777528 17:17792361-17792383 TTGTGTGCACGCATGTGCGTGGG + Intronic
1147177008 17:38662227-38662249 GTGTGTGTGTGCATGTGCATAGG + Intergenic
1147585528 17:41652191-41652213 GTGTGTGCATGCATGTGTGTTGG - Intergenic
1147946834 17:44085102-44085124 GTGTGTTCCCGCACATGCACTGG + Exonic
1149001875 17:51765729-51765751 GTGTGTGCATGCATGTGTTTAGG + Intronic
1150504941 17:65689053-65689075 GTGTGTGCAGCCAGGTGCAGTGG - Intronic
1151713126 17:75817970-75817992 GTGTGTGCATGCATGTGAAGAGG + Intronic
1152038470 17:77888065-77888087 GTGTGCGCGCACCCGTGCATGGG - Intergenic
1152062669 17:78090130-78090152 GTGTGTGTGTGCATGTGCATAGG + Intronic
1152148683 17:78585156-78585178 GTGTGTGTGTGCGCGTGCATAGG - Intergenic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152530792 17:80917925-80917947 GGGTGTGCACGCCCGTGGCTTGG - Intronic
1152575439 17:81138398-81138420 GTATGTGCACGCACGTGTGGGGG - Intronic
1152733454 17:81984975-81984997 GGGTGTGCACGCAGGTGTGTGGG - Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1155038041 18:22041868-22041890 GTGTGTGTACACACGTGCATGGG + Intergenic
1156089270 18:33445326-33445348 GTGTGTGCACACATGTGCATGGG + Intergenic
1156102637 18:33616424-33616446 GTGTGTACACGTGCATGCATAGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1157419086 18:47530477-47530499 GTGCGCGCATGCAGGTGCATGGG - Intergenic
1158017149 18:52797677-52797699 GTGTGTGCAGGCACCAGCAGTGG + Intronic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158379901 18:56917545-56917567 GTGTGTGCATGCATGTGTGTGGG + Intronic
1158400924 18:57121187-57121209 GTGTGTGCACGCGAGTGCGCAGG + Intergenic
1161086215 19:2336173-2336195 GTGTGTGGGGGCATGTGCATGGG + Intronic
1161280863 19:3444845-3444867 ATATATGCACGCACGTGCACAGG + Intronic
1161839585 19:6671265-6671287 GTGTGTGTGCGCACTTGCACGGG + Intergenic
1163314908 19:16535234-16535256 ATGGGTGCACGCACGTCCAGTGG + Intronic
1163597917 19:18231281-18231303 GTGTGCACACACACGTGCACAGG + Intronic
1163649607 19:18509572-18509594 GCGCGCGCGCGCACGTGCATTGG - Intronic
1164725738 19:30464610-30464632 ATGTGTGCAGCCAGGTGCATTGG + Intronic
925072475 2:981832-981854 GTGTGTTCACGTGCATGCATGGG - Intronic
925406951 2:3612201-3612223 GCGTGTGTCCGCATGTGCATAGG - Intronic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927155777 2:20220350-20220372 GTGTGTGTGCGCATGTGTATGGG - Intronic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927917106 2:26944387-26944409 GTGTGTGCATGCATGTGTATGGG - Intronic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
930003444 2:46877553-46877575 GTTTGTGCACGCGCGTGTCTGGG - Intergenic
932221888 2:70006110-70006132 GTGTGTGCGCACATGGGCATGGG - Intergenic
932423817 2:71616504-71616526 GTGTGTGCACGAGCTTCCATGGG + Intronic
933837101 2:86254954-86254976 GTGTGTGCCCTCACCTTCATAGG - Intronic
934704709 2:96468908-96468930 GTGTGTACACAGACATGCATAGG + Intergenic
937300829 2:120840404-120840426 GTGCATGCACGCGTGTGCATGGG + Intronic
937804392 2:126121423-126121445 GTGTGTGCAAGCAAGTGTAGGGG - Intergenic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
939758204 2:146139294-146139316 GTGTGTGCATGCATATGCACAGG + Intergenic
940176904 2:150888119-150888141 GTGTGTGCATGCATGTGAGTTGG - Intergenic
940405055 2:153291892-153291914 GTCTTTGCATGCACGTGCAGTGG + Intergenic
1169891935 20:10462888-10462910 TTATGTGCACACAAGTGCATGGG + Intronic
1170785596 20:19464445-19464467 TTGTGAGCATGCACGTGAATGGG - Intronic
1170933238 20:20787825-20787847 GTGTGTGCACGCCTGTGTGTGGG - Intergenic
1171183491 20:23108491-23108513 GTGTGTGCACGTAGGTGCACAGG + Intergenic
1171262900 20:23748779-23748801 GTGTGTGCAGGGAGGTGGATGGG - Intronic
1172780649 20:37435091-37435113 CTGTGTGCATGCATGTGCCTGGG + Intergenic
1173119388 20:40275014-40275036 GTGTGTGCATGTACATGCTTGGG + Intergenic
1173503710 20:43571264-43571286 ATGTGTGCATGCATGTACATAGG + Intronic
1174729301 20:52899231-52899253 GTGGGGGCAAGCACATGCATGGG + Intergenic
1174887018 20:54347078-54347100 GTGTGTGCATGTGCGTGCTTTGG + Intergenic
1175793856 20:61758915-61758937 GTGTGTGCACCTGTGTGCATGGG + Intronic
1176176902 20:63732370-63732392 GTGTGTGCGCGCATGTGTGTGGG + Intronic
1180032792 21:45223803-45223825 CTGTGTGGACACACGTGGATGGG - Exonic
1180055024 21:45353175-45353197 GTATGTGCACACACATGCACAGG + Intergenic
1180766947 22:18350974-18350996 GTGTGTGTGTGCACGTGCACTGG + Intergenic
1180779367 22:18511405-18511427 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1180812082 22:18768725-18768747 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1181198238 22:21202969-21202991 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1181648046 22:24244284-24244306 GTGTGTGTGTGCACGTGCACTGG - Intronic
1182051007 22:27312779-27312801 ATGTGTACACACACATGCATAGG + Intergenic
1183614847 22:38937641-38937663 GTGGGTGCACGTGTGTGCATGGG + Intergenic
1183694029 22:39409464-39409486 ATGTGTGCACGTATGTGCCTGGG - Intronic
1184127035 22:42494780-42494802 GCGTGCGCACACACATGCATAGG + Intergenic
1184730884 22:46370325-46370347 GTGTCTGCATGCATGTGTATAGG - Intronic
1184980395 22:48091452-48091474 GAGGGTGCAGGCAGGTGCATGGG - Intergenic
1185100402 22:48837638-48837660 GTGTGCGCACGTGTGTGCATGGG - Intronic
1185132747 22:49049077-49049099 ATGTGTGCATGAACCTGCATGGG - Intergenic
1203228569 22_KI270731v1_random:91868-91890 GTGTGTGTGTGCACGTGCACTGG + Intergenic
949184568 3:1174882-1174904 GTGTGTGCACACGCGTGTGTGGG - Intronic
949255000 3:2035543-2035565 GTGTGTGCACACATGTGCTGAGG - Intergenic
950215171 3:11154123-11154145 TTGTGTGCCCGCAGGTGCGTGGG + Intronic
953284480 3:41593389-41593411 GTGTGTGCATGCATGTGTGTAGG - Intronic
954679962 3:52339824-52339846 GTGTGTGTACACACGTGCTGGGG + Intronic
955151472 3:56371555-56371577 GTGTGTGCATGCATGTGGTTGGG - Intronic
955861422 3:63334552-63334574 GTGTGTGGACACACGTGGACAGG + Intronic
957556836 3:81773168-81773190 GTGTGTGCATGTAGGTGGATGGG + Intergenic
957636473 3:82791480-82791502 GTGTGTGAACGAACGAGCATGGG - Intergenic
958606552 3:96364960-96364982 GTGTGTGCAGGCACTAGCAGTGG - Intergenic
959034276 3:101342281-101342303 GTATGTGCATGCATGTGCACAGG + Intronic
959111401 3:102127186-102127208 GTGTATGCATGCACATCCATAGG - Intronic
959778418 3:110199344-110199366 GTGTGTGCACACAGGTGCACTGG - Intergenic
961781213 3:129321282-129321304 GTGTGTGTGAGCACGTGAATGGG - Intergenic
961867734 3:129966172-129966194 GTATGTGTATGCACATGCATGGG - Intergenic
962304899 3:134277495-134277517 GTGTGTGCATGCACACGCACAGG + Intergenic
963922699 3:150921388-150921410 GTGTGTGCGTGCACATGCAGGGG - Intronic
964006842 3:151840423-151840445 GTGTGTGCACACATGCGCGTGGG - Intergenic
964008836 3:151865109-151865131 GTGTGTGTGTGCACGCGCATTGG + Intergenic
964733780 3:159894952-159894974 GTATGTGCGTGCATGTGCATAGG + Intronic
965024455 3:163282555-163282577 GTGTGTGGAGGCACATGAATTGG + Intergenic
966161277 3:176971299-176971321 GTGTGTGCATGCACGTGCTTCGG + Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
966886046 3:184378722-184378744 GTATGTGCGCACACGTGCACTGG + Intronic
967778281 3:193407257-193407279 GTGTGTGCACGCATGTGTGTAGG - Intronic
968447547 4:659730-659752 GTGTGTGCTCACATGTGCACAGG + Intronic
968523112 4:1043262-1043284 ATGTGTGCACGCATGTATATGGG - Intergenic
970221429 4:13815876-13815898 GTGTGTGTACACACGGACATAGG - Intergenic
971257729 4:25030054-25030076 GTGTGTGTAGGGGCGTGCATAGG - Intronic
972291797 4:37696591-37696613 GTGTGTGTATGCATGTGCCTCGG - Intergenic
972406810 4:38754127-38754149 GTGTGTGCATGTATGTGTATGGG - Intergenic
973163617 4:47050120-47050142 GTGTGTGCCCGAATGTGAATGGG - Intronic
973263668 4:48188894-48188916 GTGTGTGCGCGCATATGCATGGG - Intronic
977845233 4:101759878-101759900 GTGTGCACACGCACATGCAGGGG + Intronic
979231252 4:118351910-118351932 GTGTGTGTGCGCTCGTGTATTGG - Intronic
980340442 4:131538185-131538207 ACGTGTGCATGCACGTGCAATGG + Intergenic
981108701 4:140910922-140910944 GTGTGGGCAGGCAGGAGCATGGG + Intronic
981497303 4:145408811-145408833 GTGAGTGAAAGCACGTGTATGGG + Intergenic
983450210 4:167900119-167900141 GTGAGTGCACACAAGTGCCTTGG + Intergenic
983562846 4:169118206-169118228 GTGTGTGCATGCATGTACATGGG - Intronic
983747621 4:171221240-171221262 GTGTGTGTGTGCACGTACATGGG + Intergenic
985053071 4:186012238-186012260 GTGTGTGCACACACACGCATAGG + Intergenic
985074700 4:186202607-186202629 GTGTGTGCATGTGTGTGCATGGG - Intronic
985674235 5:1222072-1222094 GTGTGTGCATGTACATGCATGGG + Exonic
985702433 5:1381753-1381775 GTGTGGGCATGCATGTGTATGGG - Intergenic
985776488 5:1846777-1846799 ATGTGTGCACATGCGTGCATAGG + Intergenic
985895918 5:2750077-2750099 CTGTGTGCGCGCACGTGCAAGGG - Intronic
985963944 5:3325250-3325272 GTGTGAGCGCGCGCGTGCGTGGG + Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
989558332 5:42822706-42822728 ATGTGTGCATGCATGTGCATTGG + Intronic
990977774 5:61574332-61574354 GTGTATGCACATATGTGCATGGG - Intergenic
994758568 5:103825173-103825195 GTGTGTGTGCACACATGCATGGG - Intergenic
994891435 5:105640523-105640545 GTGTGTGAACGAAGGAGCATGGG - Intergenic
995010520 5:107252639-107252661 TTGTGTGCAAACACGTGCATGGG - Intergenic
998608578 5:143663085-143663107 GTGTGCACACGGACGTGCAAAGG - Intergenic
1001245729 5:170104852-170104874 GTGTGTGCGCGTGCGTGCGTGGG + Intergenic
1001799602 5:174531530-174531552 GTGTGTGCACACCTGTGCCTGGG + Intergenic
1003009512 6:2413629-2413651 GTGTTTGCATGCACGTGCTCAGG - Intergenic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004770806 6:18779093-18779115 GTGTGTGCATGCACGTGTATTGG + Intergenic
1004948482 6:20641836-20641858 GTGTGTGTACACATGTGTATGGG + Intronic
1005091327 6:22059914-22059936 GTGTGTGTATGCACATGCATGGG + Intergenic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1010002565 6:70962480-70962502 TTGTGTGCACACGCATGCATGGG + Intergenic
1010354895 6:74921317-74921339 GTGTGTGCACGCTCATGAGTAGG - Intergenic
1012989529 6:105911136-105911158 GTGTGTGTTTGCACGTGCACTGG - Intergenic
1013193506 6:107824889-107824911 GTGTGTGCACACACCTGGATAGG - Intergenic
1014189915 6:118483420-118483442 GTGTGTGCATGCATGTGTATGGG + Intronic
1015576514 6:134677422-134677444 GTGTGTGCATGTGTGTGCATAGG - Intergenic
1017175081 6:151494720-151494742 GTGTGTGTGCGCGCGCGCATTGG - Intronic
1017973983 6:159338224-159338246 GTGTGTGCAGGCACCTGCTGTGG - Intergenic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018619421 6:165715593-165715615 ATGTGTACATGCATGTGCATGGG - Intronic
1019043546 6:169125495-169125517 GGGTGTGCACACAGGTGAATGGG - Intergenic
1019127906 6:169853544-169853566 GTGTGTGCACACACGTGCCCTGG + Intergenic
1019183150 6:170205167-170205189 GTGTGCACATGCGCGTGCATAGG - Intergenic
1019183281 6:170206160-170206182 GTGTGAGCACGTGTGTGCATGGG + Intergenic
1019352991 7:563893-563915 ATGTGTGCACACGTGTGCATGGG + Intronic
1020009669 7:4801215-4801237 ATGTGTGCTCACAGGTGCATGGG - Intronic
1020130060 7:5554823-5554845 GTGTGTACACACAAGTGCACTGG + Intronic
1021044621 7:15907052-15907074 GTGTGTACGCACACGTGCACAGG - Intergenic
1022297527 7:29069822-29069844 GTGTGTGCATGTAAATGCATAGG + Intronic
1022344381 7:29500150-29500172 GTGTGTGCGCACACATGCGTAGG - Intronic
1022510239 7:30930662-30930684 GTGTGTGTGTGCACGTGCATAGG + Intergenic
1022518785 7:30992544-30992566 GAGGGTGCAGGCACGTGCCTGGG + Intronic
1023867761 7:44246567-44246589 ATGTGTGCATGCACGTGTGTGGG - Intronic
1024006127 7:45225897-45225919 GTGTGTGCACACACGTGTGGTGG + Intergenic
1024148786 7:46545380-46545402 GAGTGTGCACGTGTGTGCATTGG - Intergenic
1024295805 7:47840956-47840978 GGGTGTGCCCACAGGTGCATGGG - Intronic
1026572017 7:71539489-71539511 GTGTGTGCGTGCACGTGTACAGG + Intronic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032496296 7:132365359-132365381 GTGCGTGCGCGCGCATGCATGGG + Intronic
1033725734 7:144115839-144115861 GTGTGTGCGCGCACACGCATGGG - Intergenic
1034491048 7:151393285-151393307 CTGTGTGCACACACAGGCATAGG - Intronic
1034491052 7:151393294-151393316 GTGTGTGCACACAGGTGTGTGGG + Intronic
1034526850 7:151669819-151669841 GTGTGTGCCTGCAGGTGCACAGG - Intronic
1034894071 7:154864130-154864152 GTGTGTGCACGCAGAGGCTTAGG - Intronic
1035368855 7:158365886-158365908 GTGTGTGTGCACGCGTGCATTGG - Intronic
1035368874 7:158366058-158366080 GTGTGTGTGCACGCGTGCATTGG - Intronic
1035615508 8:997893-997915 TTGTATGCATGCATGTGCATGGG - Intergenic
1036664042 8:10727329-10727351 GTGTGTGCATGCATGTGTCTGGG - Intronic
1036762041 8:11515966-11515988 GGGTGTGCACTCGCGTGCCTGGG + Intronic
1036772221 8:11587161-11587183 GTGTGTGCGCACACACGCATGGG - Intergenic
1036981072 8:13470924-13470946 TTGTATGCATGCACGTGTATGGG - Intronic
1037692778 8:21196731-21196753 GTGTGTATACACACGTGTATAGG - Intergenic
1037692779 8:21196753-21196775 GTGTATACACACACGTGTATAGG - Intergenic
1037723124 8:21461502-21461524 GTGTGTGCGCACATGTGCATGGG - Intergenic
1038680259 8:29660379-29660401 GTGTGTGCACACGTGTGTATGGG - Intergenic
1042206670 8:66336404-66336426 GTGTGTGCATGCACGTGCCTTGG - Intergenic
1044311085 8:90693353-90693375 GTGTGTGCACGCACATGTGTAGG + Intronic
1044488667 8:92785610-92785632 GTGTGTGTGCGCGCGTGCATAGG - Intergenic
1045648058 8:104318407-104318429 GCGTGTGCACTCAGATGCATGGG - Intergenic
1045652146 8:104351294-104351316 GTGTGTGTATGCACATGTATGGG + Intronic
1045710320 8:104975561-104975583 GTGTGCGCATGCACGTGCAGGGG - Intronic
1046619201 8:116510040-116510062 ATGTGTGCACACACGTGCGAGGG - Intergenic
1046984125 8:120368961-120368983 GTGTGTGCACGCCCATAGATTGG + Intronic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1048454819 8:134568046-134568068 GTGTGTGCACTCATGTGCTGGGG - Intronic
1048544427 8:135373233-135373255 GTGTGTGTGTGCACTTGCATAGG - Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049623093 8:143607403-143607425 GTGAGTGCGTGCATGTGCATGGG - Intronic
1050291839 9:4163222-4163244 GCATGTGCACGCATGTGCACTGG + Intronic
1050299632 9:4244025-4244047 TTGTATGCACGTATGTGCATGGG - Intronic
1050367116 9:4882842-4882864 GTGTGTGCATGTGTGTGCATAGG - Intronic
1050485880 9:6134247-6134269 GTGTGTGCATGCACGTGTGACGG + Intergenic
1052261886 9:26526232-26526254 CTGTGTGCATGTATGTGCATTGG + Intergenic
1056705406 9:88948381-88948403 ATGTGTGCACGCATGTGCATGGG + Intergenic
1056782705 9:89563267-89563289 GTGTGCGCGTGCACGTGCATAGG - Intergenic
1058873281 9:109220745-109220767 GTGTGTGCACGTGCGTGTGTTGG + Intronic
1062198177 9:135286217-135286239 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198185 9:135286280-135286302 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198211 9:135286464-135286486 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062267050 9:135691776-135691798 GTGTGTGCACACGCGTTCGTGGG - Intergenic
1062639677 9:137512225-137512247 ATGTGTACACGCTCGTGCAGTGG + Intronic
1185700973 X:2229568-2229590 GTGTGTGCACAGATATGCATAGG + Intronic
1186006974 X:5083151-5083173 GTGTGTGCATACATGTTCATGGG - Intergenic
1186490596 X:9969424-9969446 GTGTGTGTGCGCGCGTGCACTGG - Intergenic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1189364221 X:40375836-40375858 GTGTGTACACGCATGTGTGTGGG + Intergenic
1189554096 X:42124289-42124311 GTGTGCGTACGCACATGCGTTGG + Intergenic
1190288264 X:48974675-48974697 GTGTGTGGACCCATGGGCATGGG + Intronic
1192148312 X:68696334-68696356 GTGTGTGCGCACGTGTGCATGGG + Intronic
1192483913 X:71508756-71508778 GTGTGTGCGCGCATATGCATAGG + Intronic
1192634673 X:72806052-72806074 GTCTGTGCATACATGTGCATGGG - Intronic
1192647040 X:72914749-72914771 GTCTGTGCATACATGTGCATGGG + Intronic
1193593530 X:83419311-83419333 GTGCATGCACACACGTGCACTGG - Intergenic
1195117063 X:101709729-101709751 GTGTGTGCACACGTATGCATGGG + Intergenic
1195922580 X:109998333-109998355 GTGTGTGCGTGCACGTGCTTGGG + Intergenic
1197559848 X:128006303-128006325 GTGTGTGCACGCGCACGCGTGGG - Intergenic
1197827582 X:130606476-130606498 GTGTGTGTATGTATGTGCATGGG - Intergenic
1198671802 X:139089146-139089168 GTGTGTGCACGCATGTGTGTTGG + Intronic
1200067293 X:153509957-153509979 CTGTGTGCACCCACTTGCACTGG + Intergenic
1200338075 X:155373462-155373484 GTGTGCACGCGCACGTGCTTAGG - Intergenic
1200348394 X:155467232-155467254 GTGTGCACGCGCACGTGCTTAGG + Intergenic
1201011968 Y:9556589-9556611 GTGTGTGTATGCACATGCACAGG + Intergenic
1201229039 Y:11845536-11845558 GTGTATGCACACAGGTGCACTGG - Intergenic
1201765676 Y:17571588-17571610 GTGTGCGTGTGCACGTGCATAGG - Intergenic
1201835876 Y:18334401-18334423 GTGTGCGTGTGCACGTGCATAGG + Intergenic