ID: 1049531970

View in Genome Browser
Species Human (GRCh38)
Location 8:143159516-143159538
Sequence CCGAGGCGCCGCGGGAGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049531970_1049531979 7 Left 1049531970 8:143159516-143159538 CCGGCTCTCCCGCGGCGCCTCGG 0: 1
1: 0
2: 3
3: 27
4: 165
Right 1049531979 8:143159546-143159568 CAGGCACCTGACCCAGCCCGCGG 0: 1
1: 1
2: 1
3: 39
4: 320
1049531970_1049531980 8 Left 1049531970 8:143159516-143159538 CCGGCTCTCCCGCGGCGCCTCGG 0: 1
1: 0
2: 3
3: 27
4: 165
Right 1049531980 8:143159547-143159569 AGGCACCTGACCCAGCCCGCGGG 0: 1
1: 0
2: 0
3: 21
4: 268
1049531970_1049531987 24 Left 1049531970 8:143159516-143159538 CCGGCTCTCCCGCGGCGCCTCGG 0: 1
1: 0
2: 3
3: 27
4: 165
Right 1049531987 8:143159563-143159585 CCGCGGGCCCCCTACTCACCGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1049531970_1049531985 23 Left 1049531970 8:143159516-143159538 CCGGCTCTCCCGCGGCGCCTCGG 0: 1
1: 0
2: 3
3: 27
4: 165
Right 1049531985 8:143159562-143159584 CCCGCGGGCCCCCTACTCACCGG 0: 1
1: 0
2: 1
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049531970 Original CRISPR CCGAGGCGCCGCGGGAGAGC CGG (reversed) Intronic
900082656 1:870036-870058 CCGCGGCCCCGCTGGAGGGCAGG - Intergenic
901840703 1:11952305-11952327 ACGAGGAGCCCCTGGAGAGCAGG - Intronic
904130112 1:28269178-28269200 CCCAGGAGCAGAGGGAGAGCCGG + Exonic
904619038 1:31764408-31764430 GCGAGGAGCCGCGGGAGAAGGGG + Intronic
907682666 1:56578844-56578866 CCGAGGGGCCGAGGGACAGCGGG + Intronic
909392925 1:75136437-75136459 CCCGGGCGCCGCGGGCGGGCTGG - Intronic
912776259 1:112508211-112508233 CCGAGGCACAGAGGGGGAGCGGG + Intronic
912793547 1:112675415-112675437 CCCAGGCATCGCGGGAGCGCGGG + Intronic
913673360 1:121118453-121118475 CCGTGGCTCTGCGGGAGATCTGG - Intergenic
914025137 1:143905808-143905830 CCGTGGCTCTGCGGGAGATCCGG - Exonic
914663574 1:149813523-149813545 CCGTGGCTCTGCGGGAGATCCGG - Exonic
914702745 1:150149707-150149729 CCGAGCCGCCGCCGGAGCGAGGG + Intronic
916057787 1:161079926-161079948 CCGGTGCCCCGCGGGTGAGCTGG - Exonic
923014061 1:230112368-230112390 CAGAGGCGCCGGGGGAGGGGGGG + Intronic
923956804 1:239031518-239031540 CTGAGGCACCTGGGGAGAGCTGG + Intergenic
924778407 1:247126833-247126855 CCGAGGAGCCGCGGGGCTGCGGG - Intronic
924783251 1:247171587-247171609 CCGAGGAGCCGCGGGGCTGCGGG + Intronic
1063593010 10:7410386-7410408 CGGAGGAGACGCGGGAGCGCGGG + Intronic
1064030629 10:11880543-11880565 CCCAGCCGCCGAGGGAGAGGAGG + Intergenic
1064478897 10:15720002-15720024 AGGAGGCGCCGCGAGAGAGCTGG - Exonic
1065024310 10:21526347-21526369 CCGCGACGCCGCGGAAGGGCTGG - Intergenic
1065143259 10:22740446-22740468 CCCAGGAGCTGCAGGAGAGCAGG + Intergenic
1073057200 10:100710326-100710348 GGGAGGAGCCGCGGGAGGGCAGG - Intergenic
1075334187 10:121597298-121597320 CCCAGCCGCTGCGGCAGAGCAGG + Intronic
1075619445 10:123915044-123915066 CAGAGGAGCCGCGGGAGGGGAGG - Intronic
1075987039 10:126797160-126797182 CAGAGGGGCCTCGGGAGAGCTGG + Intergenic
1076178262 10:128385388-128385410 CCAAGGCGCTGCTGGAGAGGGGG + Intergenic
1077179905 11:1207601-1207623 CTGAGACGCCCCGGGAGAGGAGG - Intergenic
1077224723 11:1435001-1435023 CCGAGGCGCGGAGGGGGACCGGG + Intronic
1077257844 11:1596845-1596867 CCGAGGCCCCAGAGGAGAGCGGG + Intergenic
1078371626 11:10751276-10751298 CCGCGGCGCCGCTGGAGCTCTGG - Exonic
1079076688 11:17389031-17389053 CCGGGGAGCCGCGGTTGAGCCGG - Intronic
1081006221 11:37746713-37746735 CCCAGTCTCCGTGGGAGAGCAGG - Intergenic
1081831950 11:46121634-46121656 AGGAGGCGCCGGGGGAGAGCGGG + Intergenic
1082826634 11:57584506-57584528 CAGAGGCCTAGCGGGAGAGCTGG + Intergenic
1083436326 11:62646160-62646182 CCGAGGGGCCGCGGGGCCGCAGG + Intronic
1084804138 11:71567046-71567068 CCGAGGCCCCAGAGGAGAGCGGG - Intronic
1089347063 11:117797289-117797311 CCGGGGTGCCGCGGGGGGGCGGG - Intronic
1090964285 11:131584793-131584815 CCGAGAGGCCGAGGGCGAGCTGG + Intronic
1091581592 12:1793729-1793751 CCGAGGCGCCGCCGCAGTCCTGG + Exonic
1092163295 12:6327844-6327866 CCGAGGAGCCCCGGGACAGCAGG + Exonic
1092246730 12:6868002-6868024 CCGAGGCTCTGCGGGAGACCGGG + Intronic
1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG + Intronic
1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG + Intronic
1105247307 13:18665526-18665548 CCGAGGCCCCGCGGCGCAGCAGG - Intergenic
1105900070 13:24746027-24746049 CCGTGGCTGCGCGGGAAAGCCGG - Intergenic
1110450707 13:75635841-75635863 CCGGATCGCGGCGGGAGAGCGGG + Intronic
1110860498 13:80341003-80341025 CGGAGGCGGCGCGGGGGCGCGGG + Intergenic
1112504930 13:99969855-99969877 CCGAGGGGCTGCGGGCGCGCTGG + Intronic
1113565954 13:111320024-111320046 CCGAGATGCCGCAGGAGGGCAGG - Intronic
1115761729 14:36582883-36582905 GCCAGGCCCCGCGGGAGCGCCGG + Intergenic
1117478186 14:56118348-56118370 CCGAAGCCCCGCGGGAGGGAGGG - Intronic
1119786946 14:77320984-77321006 ACGGGGCGTGGCGGGAGAGCTGG + Exonic
1121352464 14:93184618-93184640 CCGACGAGGCGCGGGAGGGCAGG + Exonic
1122081805 14:99272039-99272061 CCGCGGCGCCAGGGGAGCGCTGG - Intergenic
1122418375 14:101560981-101561003 CCCAGGTGCCGCGGGAGGCCGGG - Intergenic
1122983062 14:105200228-105200250 AGGAGGCGCTGCGGGACAGCTGG - Intergenic
1123068011 14:105627890-105627912 CAGAGCCGCCGCAGGTGAGCAGG - Intergenic
1123068099 14:105628204-105628226 CAGAGACGCCGCAGGTGAGCAGG - Intergenic
1129540344 15:76342847-76342869 CCGCGGCGCCGAGCGAGAGTGGG - Intergenic
1129676516 15:77634799-77634821 AGGAGGCGGCGCGGGAGGGCGGG - Intronic
1132345669 15:101107267-101107289 CAGAGGCGCTGCGGGAGAGTTGG + Intergenic
1132586056 16:706121-706143 GCGAGGGGAGGCGGGAGAGCAGG + Intronic
1132850002 16:2020628-2020650 CGGAGGCGCCACGGGCGGGCGGG - Exonic
1132887831 16:2190229-2190251 CCTAGGTGCCGGGGGAGGGCAGG - Intronic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136261747 16:29082149-29082171 CCGAGGAGACGCGGGAGACCCGG - Intergenic
1136776978 16:32877261-32877283 CCGAGGCACCTGGGAAGAGCAGG - Intergenic
1136893639 16:33984252-33984274 CCGAGGCACCTGGGGAGAGCAGG + Intergenic
1139365022 16:66427621-66427643 TCGAGGGTCCGCGGGAGACCCGG - Intronic
1139451095 16:67028900-67028922 CCGAGTGGCCGCGGGCGAGCAGG + Intergenic
1141911753 16:87064897-87064919 CAGAGGCGCCGGGGAAGACCGGG + Intergenic
1142156287 16:88534150-88534172 CACAGGCGCGGCGGGAGAGGGGG - Exonic
1142212319 16:88814196-88814218 CTGAGGCGCCGTGGGCGAGGAGG + Exonic
1142212328 16:88814232-88814254 CTGAGGCGCCGTGGGCGAGGAGG + Exonic
1203079394 16_KI270728v1_random:1139370-1139392 CCGAGGCACCTGGGGAGAGCAGG - Intergenic
1142631716 17:1229850-1229872 CGGAGCCGCCGGGGGAGGGCGGG + Intergenic
1144496549 17:15749635-15749657 GAGAGGCGCCGCGGGATGGCAGG - Intergenic
1144905029 17:18635064-18635086 GAGAGGCGCCGCGGGATGGCAGG + Exonic
1147200699 17:38799596-38799618 CCGGGGCGGGGCGGGAGGGCGGG - Exonic
1148930148 17:51120937-51120959 GCGGGGCGCCGCGGGAGGCCAGG + Intergenic
1151188859 17:72383119-72383141 CCTAGGAGCCCCGGGAGGGCGGG + Intergenic
1151764488 17:76125125-76125147 CCCAGGTGAAGCGGGAGAGCGGG + Intergenic
1152513096 17:80803563-80803585 CCGAGGCCCCGCTGACGAGCTGG - Intronic
1152544101 17:80992144-80992166 CCGAGGCCCCGCGGGCGAGGAGG - Intronic
1153285639 18:3452129-3452151 CCAAAGTGCCGCGGGAGAGTCGG - Exonic
1154241513 18:12657786-12657808 GCGAGGGGCCGCGGGAGCCCGGG - Exonic
1154441532 18:14393595-14393617 CCGAGGCCCCGCGGCGCAGCAGG + Intergenic
1155007436 18:21741322-21741344 CGGAGGCGGCGGCGGAGAGCGGG - Exonic
1160392182 18:78542387-78542409 CCCAAGAGCCGCGGGAGGGCAGG + Intergenic
1160624271 18:80192423-80192445 CCCAGGGGACGGGGGAGAGCAGG + Intronic
1160624285 18:80192460-80192482 CCCAGGGGACGGGGGAGAGCAGG + Intronic
1160624299 18:80192497-80192519 CCCAGGGGACGGGGGAGAGCAGG + Intronic
1160749577 19:727565-727587 CCAAGGCACTGCGGGAGCGCTGG + Exonic
1161531404 19:4792157-4792179 CCGAGGCCCCGCGGCGCAGCAGG - Exonic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1167501467 19:49851075-49851097 CCAAGGCGGCGCGGGGGAGCGGG - Intronic
1168294019 19:55370076-55370098 CAGAGGCGCCGCAGGAGGGACGG - Intronic
926077380 2:9951936-9951958 CCGAGGCCGCGCGGGCGGGCGGG + Intronic
927713987 2:25341304-25341326 CCGCGGCGGCCCGGGGGAGCGGG - Intronic
927812168 2:26186254-26186276 CCGGGGGGCTGCTGGAGAGCCGG - Exonic
931515904 2:63050633-63050655 CCGGGGCGGGGCGGGAGGGCGGG + Intronic
934636185 2:95991973-95991995 CGGAGGTGCCGCGGGAGGGCGGG + Intergenic
934797464 2:97113453-97113475 CGGAGGTGCCGCGGGAGGGCGGG - Intergenic
934835947 2:97589986-97590008 CGGAGGTGCCGCGGGAGGGCGGG + Intergenic
942116648 2:172735556-172735578 CTGAGGCGGGGCGGGAGGGCAGG - Intronic
942151037 2:173076088-173076110 CCGAGGCTCCGCCGGAGCCCGGG + Intronic
943639550 2:190343677-190343699 CCGCGGTCCCGCGGGAAAGCCGG + Exonic
948645146 2:239400198-239400220 CCGGGGGGTCGCGGGAGGGCGGG - Intronic
1169278442 20:4248741-4248763 CCGGAGCTCCGCGGGGGAGCCGG - Exonic
1169367235 20:5001427-5001449 CCGAGGCGCGGCGGCAGGACGGG - Intronic
1170578303 20:17681072-17681094 TCAGGGCGCAGCGGGAGAGCCGG + Intronic
1171986380 20:31664397-31664419 AGGAGGGGCCGCTGGAGAGCTGG - Intergenic
1172037339 20:32019244-32019266 CGGCGGCGGCGCGGGAAAGCCGG + Exonic
1172750332 20:37246132-37246154 CTCAGGCGCCCAGGGAGAGCAGG + Intergenic
1173662901 20:44746233-44746255 CAGAGGCGCCCCGGGACGGCTGG - Intronic
1174066291 20:47868070-47868092 AGGAGGCCCCGCAGGAGAGCAGG + Intergenic
1174157787 20:48528033-48528055 AGGAGGAGCCGCAGGAGAGCAGG - Intergenic
1175215678 20:57390738-57390760 CAGAGGCCCCGCGGGAGATGAGG - Intergenic
1175485329 20:59342101-59342123 CACAGGCGCTGCGGGAGGGCCGG - Intergenic
1175782895 20:61694903-61694925 CCCGTGCGCCGCCGGAGAGCTGG + Intronic
1175847596 20:62066483-62066505 CCAAGCCGCCGCGGGGAAGCTGG + Intergenic
1176454528 21:6897580-6897602 CCGAGGCCCCGCGGCGCAGCAGG - Intergenic
1176832701 21:13762628-13762650 CCGAGGCCCCGCGGCGCAGCAGG - Intergenic
1178876853 21:36420507-36420529 GTGAGGCGCCCTGGGAGAGCTGG + Intergenic
1179150575 21:38805643-38805665 CGGAGGCGGCGAGGGAGCGCGGG - Intronic
1182809716 22:33105526-33105548 CCGAGGCTCCCCGAGAGAACTGG + Intergenic
1183665103 22:39242465-39242487 CCGGGGGGCTGCGGGAGAGGCGG + Intronic
1184153154 22:42649823-42649845 CGGAGGCGCCGCCGGCGAGGAGG - Intergenic
1184568948 22:45310170-45310192 CGGAGGCGCCGCAGGTGAGGGGG + Exonic
1185340337 22:50288126-50288148 CCGAGGCCCCGGGACAGAGCTGG - Intronic
954371565 3:50171799-50171821 CAGAGGCGCCGCTGGACAGGCGG + Intronic
961359288 3:126357111-126357133 CGGAGGCACCGCGCGAGTGCTGG - Intronic
961739995 3:129027274-129027296 CCGAGGTGCCGGCGGGGAGCTGG + Intronic
961825323 3:129596318-129596340 CCCAGGCGCCAGGGCAGAGCAGG - Intronic
963236760 3:142963741-142963763 CCGAGGCGCGGAGGGAGGGACGG + Intergenic
968174019 3:196533529-196533551 TGGGGGCGCCGCAGGAGAGCAGG + Intergenic
968479508 4:827007-827029 ACGCGGCACTGCGGGAGAGCGGG + Intergenic
968486282 4:864538-864560 ACCAGACGCCGCGGGAGGGCCGG + Intronic
970193381 4:13534999-13535021 CCAGGGAGGCGCGGGAGAGCTGG - Intergenic
976246860 4:83013019-83013041 ACGAGGCGCCGCGGAAGAGGCGG - Intergenic
978795774 4:112706087-112706109 CCGAGGAGACGCGGGAGACCCGG + Intergenic
984760205 4:183357019-183357041 CCGGGGCGGGGCGGGAGAGTAGG - Intergenic
985688483 5:1294481-1294503 CCGACGCACTGCGGGGGAGCGGG - Exonic
988547808 5:32174353-32174375 CAGAGTCGGCGCGGGAGAGCTGG + Intergenic
988577876 5:32444383-32444405 CCGAGACGCCGAGGGAGGGCAGG + Intronic
990308799 5:54518558-54518580 CCGAGCCGCCGCGGGAACCCAGG - Exonic
992098175 5:73381586-73381608 CTGAGGCGCCGCGGGAGCGCAGG - Intergenic
1002698941 5:181109116-181109138 CCGAGGCTCCTCGGGTGTGCTGG + Intergenic
1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG + Intronic
1003099038 6:3163120-3163142 CCGCGGCGCAGGGGGAGGGCGGG + Intergenic
1004216935 6:13711763-13711785 CGGGGGCGACGCGGGAGCGCGGG + Intergenic
1005965106 6:30721433-30721455 CCGGGGCGCCGTGGGCGCGCGGG + Intronic
1006177508 6:32131302-32131324 CCGAGGCGGCGGGGGGGGGCGGG + Intergenic
1012475975 6:99614644-99614666 CCCAGGCTCCGGGGGATAGCCGG - Exonic
1017738122 6:157381640-157381662 CCGAGGCGCGGCCGGGGAGCCGG + Exonic
1019534945 7:1523931-1523953 CCGGGGCGCCCCGGGAGGGGTGG - Intergenic
1019964891 7:4490724-4490746 CCGTGGCCCAGGGGGAGAGCAGG - Intergenic
1020023476 7:4883168-4883190 GCGGGGCGCAGCGGGGGAGCGGG - Intronic
1020107634 7:5429464-5429486 CTGGGGCGCCGCGGCAGGGCTGG - Intergenic
1021510537 7:21428144-21428166 CCGAGCCACCGCGGGCGGGCGGG + Exonic
1021868367 7:24980203-24980225 CCGAGGAGCCGCGCAAGGGCGGG + Intronic
1022090818 7:27106930-27106952 CCGAGGCGAGCCGGCAGAGCAGG - Exonic
1022207752 7:28180230-28180252 CCGAGGTGCCGCGGGCGGGCGGG - Intronic
1023810210 7:43906241-43906263 CCGGGGCGCGGCGGGAGCGAGGG - Intronic
1024520906 7:50303904-50303926 CCGCAGCGCCGCGGCCGAGCCGG + Intergenic
1024996860 7:55278845-55278867 CCGAGGAGCCGAGGGATTGCTGG - Intergenic
1025017227 7:55449329-55449351 CAGTGGCGCCGCGGGAGACTGGG - Intronic
1026471059 7:70694419-70694441 CCGCGGCGCGGCTGGAGAGGCGG + Intronic
1026904783 7:74056745-74056767 CCTGAGCCCCGCGGGAGAGCAGG - Intronic
1031043520 7:116862820-116862842 CCGAGGCCCCGCGCGGGGGCAGG + Intronic
1032192585 7:129773160-129773182 CCGAGGGGCAGAGGGAGAGCTGG + Intergenic
1033220399 7:139523652-139523674 GCGAGGCGGCGCGCGGGAGCCGG - Intergenic
1033406157 7:141073162-141073184 CGGAGGCGTCGCGGGAGAGCCGG + Intergenic
1034422382 7:150996466-150996488 CCGGGGGGCCGGGGGAGGGCCGG - Exonic
1034440516 7:151083446-151083468 CCGAGGGGCCGCGATGGAGCTGG - Intronic
1037876664 8:22551974-22551996 CCGAGGCCGCCCGGGAGCGCAGG - Exonic
1049440891 8:142609251-142609273 GCGAGGGGCCCTGGGAGAGCAGG - Intergenic
1049531970 8:143159516-143159538 CCGAGGCGCCGCGGGAGAGCCGG - Intronic
1049643926 8:143727754-143727776 CCGAGGCGGAGCCGGAGCGCAGG - Exonic
1051655775 9:19380216-19380238 CCGAGGCGCCACGGAAAAGAGGG + Exonic
1056154056 9:83817568-83817590 CCGGGGAGCCGCGGGAGAGGCGG - Exonic
1056356441 9:85805525-85805547 CTGGGGAGCCGCGGGAGAGGCGG + Intergenic
1056369671 9:85941383-85941405 CTGACGCGCAGCGGGAGGGCCGG - Intronic
1057573302 9:96219826-96219848 GCTAGGGGGCGCGGGAGAGCAGG - Intergenic
1057881500 9:98796182-98796204 CCGAGGCACCGCGGCGCAGCAGG + Exonic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1059234497 9:112750689-112750711 CCGAGGCGCCGCGGCCGCCCGGG - Intergenic
1059305403 9:113349767-113349789 CCGAGGAGCTGCGGGTGAGCGGG + Exonic
1061610057 9:131740081-131740103 CCGAGGCCCGGCGGGCGGGCGGG - Intergenic
1061773595 9:132945782-132945804 GCGAGGCGGCTCGGGAGAGAAGG + Intronic
1062596762 9:137302994-137303016 CCGGGGCGCAGCGGGAGGGTCGG + Intergenic
1190862550 X:54358203-54358225 CCTCGGCGCCGCGGGAGAGAGGG + Intronic
1194977893 X:100411282-100411304 CCGAGACCCCGCGGGAAGGCTGG - Intergenic
1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG + Exonic