ID: 1049532293

View in Genome Browser
Species Human (GRCh38)
Location 8:143160491-143160513
Sequence GGGCGCCGCGAGGGAGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 729}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049532293_1049532311 20 Left 1049532293 8:143160491-143160513 CCGCTCCCTCCCTCGCGGCGCCC 0: 1
1: 0
2: 6
3: 58
4: 729
Right 1049532311 8:143160534-143160556 GCGGCCCCCTACCCAGGCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 91
1049532293_1049532313 24 Left 1049532293 8:143160491-143160513 CCGCTCCCTCCCTCGCGGCGCCC 0: 1
1: 0
2: 6
3: 58
4: 729
Right 1049532313 8:143160538-143160560 CCCCCTACCCAGGCGTGGGCAGG 0: 1
1: 0
2: 1
3: 21
4: 220
1049532293_1049532310 19 Left 1049532293 8:143160491-143160513 CCGCTCCCTCCCTCGCGGCGCCC 0: 1
1: 0
2: 6
3: 58
4: 729
Right 1049532310 8:143160533-143160555 CGCGGCCCCCTACCCAGGCGTGG 0: 1
1: 0
2: 2
3: 9
4: 116
1049532293_1049532302 1 Left 1049532293 8:143160491-143160513 CCGCTCCCTCCCTCGCGGCGCCC 0: 1
1: 0
2: 6
3: 58
4: 729
Right 1049532302 8:143160515-143160537 CTGCTCCTCCCCAGCCTCCGCGG 0: 1
1: 1
2: 11
3: 58
4: 691
1049532293_1049532307 14 Left 1049532293 8:143160491-143160513 CCGCTCCCTCCCTCGCGGCGCCC 0: 1
1: 0
2: 6
3: 58
4: 729
Right 1049532307 8:143160528-143160550 GCCTCCGCGGCCCCCTACCCAGG 0: 1
1: 1
2: 3
3: 23
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049532293 Original CRISPR GGGCGCCGCGAGGGAGGGAG CGG (reversed) Intronic
900182144 1:1315789-1315811 GCGGGCAGCGAGGGAGGCAGGGG + Intronic
900227099 1:1538411-1538433 GGGCTCCGCGGGGCAGGCAGAGG - Intronic
900344573 1:2204912-2204934 GGGGGCCCGAAGGGAGGGAGGGG - Intronic
900382499 1:2391818-2391840 CGGCGCCGCGGAGGACGGAGCGG + Exonic
900478359 1:2886766-2886788 GGGCGCTGGGAGGCTGGGAGTGG - Intergenic
900589945 1:3454980-3455002 GGGCTCCGCCGGGGCGGGAGAGG + Intronic
900748086 1:4374855-4374877 GGGTGCTGTGAGGTAGGGAGAGG + Intergenic
900996638 1:6126547-6126569 GCGTGCCGGGAGGGAGGGACTGG - Intronic
901080278 1:6580146-6580168 GCGCGGGGTGAGGGAGGGAGGGG + Intronic
902475765 1:16686130-16686152 GGGCGACACGAGGGAGCGCGCGG + Intergenic
902520322 1:17011968-17011990 GGGCGCTGCGAGGGCCGCAGAGG - Intergenic
902605307 1:17565851-17565873 GGAGGCAGCCAGGGAGGGAGGGG - Intronic
902659847 1:17893415-17893437 GGGAGCATTGAGGGAGGGAGGGG - Intergenic
902712539 1:18250084-18250106 GGAGGGAGCGAGGGAGGGAGTGG - Intronic
902880860 1:19370956-19370978 GGGCCCCATGAGGGAGGGACTGG + Intronic
903263624 1:22143675-22143697 GGGGGCCAGGAGGCAGGGAGGGG - Intronic
903466391 1:23554971-23554993 GGGCGCCGGGAGGGGCGGGGCGG + Intergenic
903526505 1:23995003-23995025 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
903777006 1:25799966-25799988 GGGCGCGGAGAGGCAGGAAGCGG + Intergenic
903923414 1:26817409-26817431 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
904271727 1:29354638-29354660 GGGAGCCGTGAGGGAGGGGAAGG - Intergenic
904497604 1:30895860-30895882 GGGAGGAGGGAGGGAGGGAGGGG + Intronic
904794815 1:33051279-33051301 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
905068324 1:35203565-35203587 GGATGCAGAGAGGGAGGGAGAGG - Intergenic
905446120 1:38029518-38029540 GGGAGCCGGGAGCCAGGGAGCGG + Intergenic
905878620 1:41449182-41449204 GGGGGTCGGGAGGGAGGGGGTGG + Intergenic
905912040 1:41662020-41662042 GGGAGCCGCGTCGGTGGGAGAGG - Intronic
906294005 1:44637987-44638009 GGGGGCCACGAGGCAGAGAGCGG + Intronic
906299887 1:44674218-44674240 GGGCGGCCCGAGGGAGGGCGGGG + Intronic
906436919 1:45804005-45804027 GAGCGCCGCCCGGGAGGCAGCGG + Exonic
906486645 1:46240440-46240462 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
907118673 1:51990450-51990472 GGGCGCCGAGAAGGAGCGCGGGG - Intronic
907445018 1:54501933-54501955 GGGCCCAGCAAGGCAGGGAGTGG - Intergenic
907453926 1:54563103-54563125 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
909081059 1:71112198-71112220 GGGTGGGGCGAGGGGGGGAGTGG + Intergenic
910004064 1:82373541-82373563 GGGGGGAGGGAGGGAGGGAGGGG - Intergenic
910221491 1:84893246-84893268 GGGCGGGGCGGGGCAGGGAGGGG - Intergenic
910474864 1:87595748-87595770 GGACGGAGGGAGGGAGGGAGGGG - Intergenic
911527608 1:99004943-99004965 CGGGGTCGCGAGGGAGGGCGGGG + Intronic
912825489 1:112899353-112899375 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
912844655 1:113068752-113068774 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
913314069 1:117535259-117535281 GGGAGAGGCGAGGGAGAGAGGGG - Intergenic
913671116 1:121097875-121097897 CGGCGGCGGCAGGGAGGGAGCGG + Intergenic
914022883 1:143885296-143885318 CGGCGGCGGCAGGGAGGGAGCGG + Intergenic
914661370 1:149793240-149793262 CGGCGGCGGCAGGGAGGGAGCGG + Intronic
914790842 1:150876406-150876428 GGGGGCCGCGAGAGACGGTGGGG - Intronic
915325688 1:155080333-155080355 GGGCGCGAGGAGGGAGAGAGGGG - Intronic
915572364 1:156751514-156751536 GGGCCGCGCGAGGGCCGGAGCGG - Intronic
915691567 1:157695935-157695957 AGGCACGGGGAGGGAGGGAGGGG - Intronic
916528616 1:165634778-165634800 GGGGGGAGGGAGGGAGGGAGAGG - Intronic
917131056 1:171742326-171742348 GGGCGCCGCGCCGGAGTGCGTGG + Intergenic
917869647 1:179229784-179229806 GGGCGCGGCGCGGCAGGGCGGGG - Intergenic
917929891 1:179815806-179815828 GGGAGCGGGGAGGGAGGAAGAGG + Exonic
918107708 1:181427780-181427802 GGGAGGAGGGAGGGAGGGAGGGG - Intronic
918511153 1:185316315-185316337 GGGCGGGAGGAGGGAGGGAGCGG - Intronic
919630994 1:199959947-199959969 GGGCGCCGTGAAGCAGGGGGCGG - Intergenic
919754927 1:201060855-201060877 GGGTGTGGAGAGGGAGGGAGGGG - Intronic
920029263 1:203026795-203026817 GGGCACCGCAAAGGAGGGCGAGG - Intronic
920881981 1:209888984-209889006 GGGCGCCGCGGAGCAGGGGGCGG + Intergenic
921016534 1:211197321-211197343 GGGGGCCGGGAGGGAGGCCGGGG + Intergenic
921632696 1:217454734-217454756 GGGGGCCGGGAGGGTGGGCGTGG - Intronic
922306928 1:224352552-224352574 GGGCGCCGTGGAGCAGGGAGCGG + Intergenic
922705426 1:227788048-227788070 GTTCGCCGCGGGCGAGGGAGGGG + Intergenic
922705602 1:227788599-227788621 GAGCCCCGCGAGGGCGCGAGTGG + Intergenic
923037066 1:230291891-230291913 GGGAGCGGTGAAGGAGGGAGCGG + Intergenic
924627523 1:245708061-245708083 GGGTCCCGAGAGGCAGGGAGGGG + Intronic
1062993975 10:1847575-1847597 GGGCTCCGCCAGGGTGGGAGTGG + Intergenic
1064443152 10:15371202-15371224 GCGCGGGGCGCGGGAGGGAGCGG - Intergenic
1064981991 10:21174254-21174276 GGGCGCAGCGGGGGAGGGGGCGG + Intergenic
1065743225 10:28815707-28815729 GGGCGCCGTGGAGCAGGGAGTGG + Intergenic
1066045677 10:31593739-31593761 GGGAGCAGGGAGGGAAGGAGAGG + Intergenic
1067110523 10:43396877-43396899 GGGCGCCTCGCGGGAGGGGGAGG + Intronic
1069186602 10:65429927-65429949 AGGCGCCGAGAGCGAGCGAGGGG + Intergenic
1069386064 10:67884576-67884598 GAGCGCCGAGAGGGCGGGGGCGG + Intergenic
1069680905 10:70284264-70284286 GGGCTTCGGGAGGGAGGCAGGGG + Intergenic
1069698285 10:70404060-70404082 GGGCGGGGCGAGGCAGTGAGGGG - Intergenic
1069766196 10:70861970-70861992 GGGCGCCGTGGAGCAGGGAGTGG - Intronic
1069993493 10:72328974-72328996 GGGCTCCACGGTGGAGGGAGGGG + Intergenic
1070841413 10:79490481-79490503 TGGGGCTGCGAGAGAGGGAGGGG + Intergenic
1071544774 10:86521307-86521329 GGGAGCCGGGAGGGTGGGGGAGG - Intronic
1072141588 10:92593313-92593335 GGGCGCTGTGAGGGGCGGAGGGG - Exonic
1072321634 10:94255962-94255984 GGGCGTGGGGAGAGAGGGAGGGG - Intronic
1072554018 10:96500801-96500823 GGACGGAGGGAGGGAGGGAGGGG + Intronic
1072673142 10:97446268-97446290 GGGCGCCGAGTCGGAGGGGGTGG + Exonic
1072735375 10:97875609-97875631 GGGCACAGGGAGGCAGGGAGGGG + Intronic
1072950131 10:99840162-99840184 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1073111777 10:101066918-101066940 GGGTGCGGGGAGGGAGGGGGCGG - Intronic
1073329510 10:102661272-102661294 GGCCACCGCGAGGGAGTGGGTGG + Intergenic
1074065372 10:110008249-110008271 GGCTGCCGAGAAGGAGGGAGGGG + Exonic
1074121780 10:110498550-110498572 GGGCGCCCCGGCGCAGGGAGGGG - Intronic
1074169595 10:110919534-110919556 GGGCGGGGCGAGTGGGGGAGGGG + Exonic
1074182550 10:111077198-111077220 AGGAGCCGCGACGGAGGCAGGGG - Exonic
1074377532 10:112951721-112951743 GGGGGAGGGGAGGGAGGGAGGGG - Intronic
1074964080 10:118473431-118473453 GGGAGGAGGGAGGGAGGGAGAGG - Intergenic
1075031867 10:119029536-119029558 GGGAGCCGCGCGGGCTGGAGCGG + Intergenic
1075519626 10:123136012-123136034 GGTCCCCGGGAGGGAGGGAGCGG - Exonic
1075768971 10:124917314-124917336 GGGCGCCGCCTGGGAGCGAGGGG - Intergenic
1076365003 10:129916053-129916075 GGGCTCCGAGGGGGAAGGAGAGG + Intronic
1076899412 10:133330001-133330023 GGGCCCCGCGGGGCTGGGAGAGG + Intronic
1076907819 10:133372365-133372387 GTGAGCCACGAGGGAGGAAGAGG + Intronic
1077009715 11:374679-374701 GGCCTCAGGGAGGGAGGGAGGGG + Intronic
1077048058 11:554940-554962 CGGGACCGCGAGGGAGGGCGCGG - Exonic
1077052950 11:575957-575979 CGGGGCTGCGAGGGAGGGGGCGG + Intergenic
1077077204 11:707124-707146 AGGGGCCGCGAGGGGAGGAGGGG - Intronic
1077413377 11:2413705-2413727 GGGCTCCGGGAGGGAGGGCTGGG - Intronic
1077677771 11:4212213-4212235 GGGCTGCGGCAGGGAGGGAGAGG + Intergenic
1078098679 11:8315941-8315963 GGGCAGCGGGTGGGAGGGAGGGG - Intergenic
1078246088 11:9574114-9574136 GGGCTCCGCGCGGGCGGCAGCGG - Exonic
1078327873 11:10395230-10395252 GGGGGAAGCGAGGGAGAGAGAGG + Intronic
1079090489 11:17476917-17476939 GGGCGGGGTGAGGGAGGGGGAGG - Intergenic
1081607269 11:44535274-44535296 GGGCGCCTCGAGGGCGGGGCTGG + Intergenic
1081784960 11:45739211-45739233 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1082023332 11:47552944-47552966 GGGCCGCGGGAGGGAGGGAGGGG - Intronic
1082260036 11:50071657-50071679 GGCCGCCAGGAGGGAGGCAGAGG + Intergenic
1082833895 11:57638590-57638612 GGGAGCCAAGAGGGAGGGAAGGG + Intergenic
1083039057 11:59668834-59668856 GGGGCGCGGGAGGGAGGGAGGGG + Intronic
1083225435 11:61281677-61281699 GGGCGCCGGGAGGGCGTGACGGG + Intronic
1083246052 11:61429425-61429447 GGGCGGCGCGAGGCCGGGGGCGG - Intronic
1083658359 11:64241118-64241140 GGGCGCGGCGAGGAGGTGAGCGG + Intronic
1083716700 11:64581574-64581596 GGGTGCAGGGAGGCAGGGAGAGG + Intergenic
1083743567 11:64723321-64723343 GTCCCGCGCGAGGGAGGGAGTGG - Intergenic
1083776994 11:64898877-64898899 GGGCCCCAAGAGGGAGGGAAGGG + Intronic
1083822602 11:65181631-65181653 GGGCACCGCGGGGAACGGAGGGG - Exonic
1084010931 11:66347844-66347866 GCGCGCCGGCGGGGAGGGAGAGG - Intergenic
1084019557 11:66409507-66409529 GGGCGCCTGGAGGGAGGCAAAGG - Intergenic
1084088581 11:66865950-66865972 GGAAGCCGTGAGGGTGGGAGCGG - Intronic
1084192188 11:67504324-67504346 GCCCGCCACGAGGGAGGCAGAGG + Intronic
1084319349 11:68364850-68364872 GGGCAGCATGAGGGAGGGAGAGG + Intronic
1084440192 11:69168272-69168294 AGGGGCCGGGAGGGAGGGAGAGG + Intergenic
1084516850 11:69642129-69642151 GGACGCCGCTAGGGAAGGGGGGG + Intronic
1084653729 11:70503441-70503463 GAGAGCAGGGAGGGAGGGAGTGG - Intronic
1084694851 11:70746974-70746996 GGGTGCAGGGATGGAGGGAGGGG - Intronic
1086187599 11:84038107-84038129 TGGAGCCGGGAAGGAGGGAGAGG - Intronic
1086438008 11:86800575-86800597 GGGCGCCGGGAGAGAGCGCGCGG - Exonic
1087117101 11:94537254-94537276 GGGCTGGGGGAGGGAGGGAGGGG - Intergenic
1089078914 11:115760353-115760375 GGGCGGCGGGAGGGTGGGCGTGG - Intergenic
1090367900 11:126223147-126223169 GAGCCCAGCGAGTGAGGGAGGGG + Intronic
1091709451 12:2727680-2727702 GGGCTACTAGAGGGAGGGAGTGG - Intergenic
1091762449 12:3096032-3096054 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1092166850 12:6347859-6347881 GGGCCCTGAGAGGGAAGGAGAGG - Exonic
1092239491 12:6828384-6828406 GGGAGCCGAGAGGGAGGGAGAGG - Intronic
1092253572 12:6914694-6914716 GGGCGCCGCGGCGAAGGGAGGGG - Intronic
1092432239 12:8418941-8418963 GGGCCGGGGGAGGGAGGGAGAGG + Intergenic
1092487344 12:8914402-8914424 GAGGGACGCGCGGGAGGGAGGGG + Intronic
1092572367 12:9739609-9739631 GGGCGCCGTGAAGCAGGGGGCGG + Intergenic
1093000291 12:13988607-13988629 GGGTGCCAGGAGTGAGGGAGGGG - Intergenic
1093894562 12:24562181-24562203 GAGAGCCGCGGAGGAGGGAGGGG - Intergenic
1094112711 12:26878704-26878726 GGCAGCTGCGAGGGAGGGTGTGG - Intergenic
1094753349 12:33439096-33439118 AGGCGCGGCGAGGCTGGGAGCGG + Intronic
1095439338 12:42227138-42227160 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1095687242 12:45050489-45050511 GGGCGCGGCTGGGGAGGGAGGGG + Intronic
1096022490 12:48333800-48333822 GAGCGCCGCCAGGGAGGCAGCGG - Intergenic
1096078317 12:48818364-48818386 GGCTGCGGCGGGGGAGGGAGGGG - Intronic
1096435975 12:51591331-51591353 GGCGGCGGCGAGGGAGGCAGCGG - Exonic
1096548283 12:52356273-52356295 GGGCGCCGGGAGGGACGGGAGGG - Intergenic
1096674679 12:53220160-53220182 GGGCGCCGCCGGGGGAGGAGGGG - Intronic
1096677216 12:53232281-53232303 GGGAGGAGCGAGGGCGGGAGGGG - Intronic
1097602221 12:61706875-61706897 GGGAGGGGGGAGGGAGGGAGGGG + Intergenic
1099365195 12:81759168-81759190 GGGCGGCGGGGGGGAGGGAAGGG - Intronic
1100026486 12:90134717-90134739 GGGCGGAGGGAGAGAGGGAGGGG + Intergenic
1100444804 12:94650510-94650532 GGGAGCCGCGGGCGAGGGGGCGG + Exonic
1101089501 12:101270629-101270651 GGGGGCTGCGAGTGAGGGGGTGG - Intergenic
1101191117 12:102333582-102333604 GGGAGCCGAGAGAGAGAGAGAGG - Intergenic
1101253421 12:102956438-102956460 TGGCGCCGAGAGGGAGGGGGAGG - Intronic
1101416513 12:104513140-104513162 GGGGGTGGGGAGGGAGGGAGAGG + Intronic
1101522963 12:105502041-105502063 GGGCTGGGAGAGGGAGGGAGAGG + Intergenic
1102053645 12:109880503-109880525 GGGCGCCGTGCGGGCGGAAGTGG - Intergenic
1102068113 12:109995969-109995991 GAGGGCCGCGAGGGACGGGGAGG + Intronic
1102101299 12:110281065-110281087 GGGCGGCGCGCGGGAGGGGGCGG + Intronic
1102390172 12:112543305-112543327 GGGGGGAGGGAGGGAGGGAGGGG - Intergenic
1102463760 12:113115855-113115877 GGGCTCCGTGAGGCAGGGGGAGG + Intronic
1102578383 12:113871824-113871846 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1103239020 12:119398017-119398039 GGGCGGCGGGAGGGAGGAAGGGG + Intronic
1103775609 12:123364622-123364644 CGGCCCCCCGAGGGTGGGAGTGG + Intronic
1103779488 12:123389368-123389390 GGGCGCGGCGGGGCGGGGAGCGG - Intronic
1103843808 12:123887428-123887450 GGCCGCCGTGAGGGAGGAACAGG - Intronic
1103994864 12:124822498-124822520 GGGGACCGGGATGGAGGGAGGGG + Intronic
1105322780 13:19344723-19344745 GGGCGCCGGGAGTGAGAGTGAGG - Intergenic
1105492403 13:20902117-20902139 GGCCGGCTGGAGGGAGGGAGGGG - Intronic
1105578891 13:21675490-21675512 AGGCGCCGGGAGGGGGCGAGGGG + Intronic
1105874833 13:24541992-24542014 GGGCGCCGGGAGTGAGAGTGCGG + Intergenic
1106853254 13:33818276-33818298 GGGGGCCGGGAGCGTGGGAGAGG + Intronic
1107467638 13:40665131-40665153 GGGCGCGGCGGGGGAGGGCGCGG - Intronic
1107905869 13:45060815-45060837 TGGAGCCGTGAGGGAGGAAGGGG - Intergenic
1108408054 13:50124445-50124467 GGGAGCAGCTGGGGAGGGAGCGG + Intronic
1112226556 13:97545612-97545634 GGGCGCCGTGGAGCAGGGAGCGG - Intergenic
1112506802 13:99980682-99980704 CGGCGCCGGGAGGGCGGGCGGGG + Intergenic
1112653946 13:101428627-101428649 GGGAGGAGGGAGGGAGGGAGGGG - Intergenic
1113494189 13:110714560-110714582 GGGTGCTGCGGGGGAGGGGGCGG + Intronic
1113654100 13:112057406-112057428 GGGAGCCGCGAGGGGCGGGGAGG - Intergenic
1113660714 13:112104942-112104964 GCGGGACGCGAGGGCGGGAGGGG + Intergenic
1113939458 13:114010774-114010796 GGGGGCCGCGTGGGGAGGAGGGG + Intronic
1113939466 13:114010793-114010815 GGGGGCCGCGAGGGGAGTAGGGG + Intronic
1115540969 14:34420985-34421007 GGGCGCGGCAAGGGCGGGAGAGG + Intronic
1115609542 14:35038509-35038531 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1116871634 14:50073924-50073946 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1116971020 14:51066100-51066122 GGACGGAGGGAGGGAGGGAGGGG + Intronic
1117837320 14:59820054-59820076 AGGCGCCGAGAGCGAGTGAGGGG + Intronic
1117895830 14:60485769-60485791 GGGCGCGGCGGGGGATGGGGGGG - Intronic
1118404777 14:65412607-65412629 CGGCGCAGCGAGGAAGGGGGCGG + Intronic
1119620927 14:76131344-76131366 TGGCGCCTCGGAGGAGGGAGGGG + Intergenic
1119788167 14:77327879-77327901 GGGAGCAGTGAGGCAGGGAGAGG - Intronic
1120835436 14:89035059-89035081 GAGCTCCACGAGGGAGGGACTGG - Intergenic
1120844215 14:89111975-89111997 GGGCGCCGTGGAGCAGGGAGTGG - Intergenic
1120985646 14:90332082-90332104 GGGCGCGGCGGGGCAGGGAGAGG + Exonic
1120986989 14:90343569-90343591 GGGGGCGGCGTGGGGGGGAGTGG + Intergenic
1120987000 14:90343590-90343612 GGGGGCGGCGTGGGGGGGAGTGG + Intergenic
1121011585 14:90523132-90523154 GGGAGCAGGGAGGGATGGAGGGG - Intergenic
1121199589 14:92106327-92106349 GGGGGCCGCGGGGGAAGTAGGGG + Intronic
1121634314 14:95443328-95443350 GGCCACCCCAAGGGAGGGAGAGG - Intronic
1121735868 14:96217731-96217753 GGGAGCCCCGAGGCAGGGACAGG + Intronic
1122074718 14:99228740-99228762 AGGAGCAGGGAGGGAGGGAGTGG - Intronic
1122178760 14:99939568-99939590 GGGAGCCGTGGGGGAGGGCGGGG - Intronic
1122275091 14:100587111-100587133 GGGCGCAGCGCGGAGGGGAGCGG + Intronic
1122283979 14:100640008-100640030 GGGCACTGCGAGAAAGGGAGCGG + Intergenic
1122300137 14:100726839-100726861 GGGGGCCGCGAGGGGGGAGGCGG + Exonic
1122321927 14:100860590-100860612 AGGCCCCAGGAGGGAGGGAGAGG - Intergenic
1122719960 14:103716237-103716259 GGGCGCCGGGAGGCGGGGTGCGG + Intronic
1122917538 14:104865826-104865848 GGGCCCGGCGGGGGAGGGAGCGG - Intronic
1122931175 14:104933632-104933654 GGGGACCGGGAGGGCGGGAGGGG + Exonic
1122931285 14:104933905-104933927 GGGGACCGGGAGGGCGGGAGGGG + Exonic
1122943564 14:104994500-104994522 GGGGGCCGAGAGGCAGGGGGCGG + Intronic
1122964029 14:105112732-105112754 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1122975080 14:105167705-105167727 GGGCGCGGAGAGAGAGGGAAGGG + Intronic
1123024865 14:105419832-105419854 GGCCGCGGCGCGGGCGGGAGAGG - Exonic
1123024983 14:105420165-105420187 GGGGGCCGCGAGGGCGGGCGGGG - Intronic
1123083453 14:105706712-105706734 AGGAGCGGCGAGGGAGTGAGGGG - Intergenic
1124453876 15:29822560-29822582 GGCCGCGGCGGGGGAGGGGGCGG + Intronic
1125300776 15:38252301-38252323 GGGAGCCGCGAGGGGGGCGGCGG - Intergenic
1125658998 15:41381897-41381919 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1126150905 15:45522826-45522848 GGGCGAGGCGCGCGAGGGAGGGG + Intergenic
1127512653 15:59657626-59657648 GGGCGTGGAGAGGGAAGGAGGGG + Intergenic
1128067833 15:64775518-64775540 GGGTGCGGCGGGGGAGGCAGTGG + Exonic
1128150733 15:65362120-65362142 GGGGGCCTGGAGGGAGGCAGAGG + Intronic
1128594060 15:68928987-68929009 GGGCGCCGTGGAGCAGGGAGCGG + Intronic
1128799263 15:70487115-70487137 GGGGGCCGGGAGGAAGGCAGGGG + Intergenic
1129116503 15:73368088-73368110 GGCCGCCGAGGGGGAGGGCGAGG + Exonic
1129124936 15:73431433-73431455 GGACGGAGGGAGGGAGGGAGGGG - Intergenic
1129170493 15:73804566-73804588 TGGAGCTGGGAGGGAGGGAGGGG - Intergenic
1129467526 15:75732279-75732301 GGGGGCCGAGAGGGATGGGGTGG + Intergenic
1130224352 15:82046070-82046092 GGCGGGCGGGAGGGAGGGAGTGG - Exonic
1130728095 15:86461961-86461983 GGGCTGCGTGAGGCAGGGAGGGG - Intronic
1131431737 15:92393845-92393867 GGGAGCCGGGAGGGAGCGAGCGG + Exonic
1132243243 15:100276346-100276368 GGGTGCCTGGTGGGAGGGAGTGG + Intronic
1132243287 15:100276454-100276476 GGGTGCCTGGTGGGAGGGAGTGG + Intronic
1132260023 15:100415790-100415812 GGGGGCAGGGAGTGAGGGAGGGG + Intronic
1132531207 16:450822-450844 GGGGGCGGGGAGGGAGGGAGCGG - Intronic
1132576900 16:668423-668445 GCCCGCCGCGGGGGTGGGAGCGG + Intronic
1132663771 16:1072735-1072757 GGGCGCCGGCTGGGAGGGGGCGG - Intergenic
1132683655 16:1153552-1153574 GGGCCGCTGGAGGGAGGGAGGGG + Intronic
1132687762 16:1169403-1169425 GGGCCCCGAGAGGGTGGCAGGGG + Intronic
1132688747 16:1172971-1172993 GGGTGCTGCCTGGGAGGGAGGGG + Intronic
1132807215 16:1780368-1780390 GGGCGCAGTGAGGCTGGGAGGGG - Intronic
1133446462 16:5865340-5865362 GGGCGCCAGGAATGAGGGAGGGG + Intergenic
1133883761 16:9807231-9807253 GGGGGGAGAGAGGGAGGGAGGGG + Intronic
1133995376 16:10744117-10744139 AGGCGGGGCGTGGGAGGGAGGGG + Intronic
1134318220 16:13139359-13139381 GGACGGAGGGAGGGAGGGAGGGG - Intronic
1135852310 16:25975292-25975314 GGGGGAAGGGAGGGAGGGAGGGG + Intronic
1135927689 16:26709834-26709856 GGGAGGGGGGAGGGAGGGAGGGG + Intergenic
1136237878 16:28925518-28925540 AGGGGCAGCGAGGGAGCGAGGGG - Exonic
1136289365 16:29262186-29262208 GGGCCCCTCCAGGGATGGAGAGG + Intergenic
1136365126 16:29806288-29806310 GGAGGGCGCGAGGGAGGGAGGGG - Intronic
1136402354 16:30025524-30025546 GGTCGCAGGGAGGCAGGGAGAGG - Intronic
1136559891 16:31033134-31033156 GGCCCCCGCGAGGTGGGGAGGGG - Intronic
1137348041 16:47683472-47683494 GGCGGCAGCGAGGGTGGGAGAGG - Intronic
1137785272 16:51133253-51133275 GGGGGGAGGGAGGGAGGGAGGGG + Intergenic
1138496367 16:57411677-57411699 GAGGGCAGCTAGGGAGGGAGGGG + Intronic
1138507656 16:57486275-57486297 GGGGGGCGTGAGGCAGGGAGGGG - Intronic
1139364973 16:66427449-66427471 GGGCGGCGCGGGGGAGGGGCGGG + Intronic
1139465131 16:67150354-67150376 GCGCGCCGCGAGGGCGAGGGAGG - Exonic
1139576791 16:67847084-67847106 GGCCGCCGGGGGGGGGGGAGGGG - Intronic
1139705578 16:68738199-68738221 CGACGCCGGGAGCGAGGGAGGGG + Intronic
1139754340 16:69131501-69131523 GGGGGCCGAGAGGGAGTGGGTGG - Intronic
1139806073 16:69566254-69566276 GGGCAGCGGGAGGGGGGGAGCGG - Exonic
1139919538 16:70450828-70450850 GGGCGCCGTGGAGCAGGGAGCGG + Intergenic
1141283917 16:82653638-82653660 GGGAGCAGCCAGGGAGGGGGTGG + Intronic
1141531369 16:84648807-84648829 GGGCGCCGCGGCCGGGGGAGGGG + Intronic
1141725619 16:85786552-85786574 GGGCACAGCGGGGGAGGGGGAGG + Intronic
1142303682 16:89274013-89274035 GGGCTCCGAGGAGGAGGGAGGGG + Intronic
1142303941 16:89275162-89275184 GGGCTCCGCCAGGGAGGGAGGGG + Exonic
1142344292 16:89544356-89544378 TGGCACCGTGAGGCAGGGAGAGG + Intronic
1142424896 16:89996901-89996923 GGGAGCCCTTAGGGAGGGAGGGG + Intergenic
1142596384 17:1031877-1031899 GGACGGAGGGAGGGAGGGAGGGG - Intronic
1142699220 17:1649338-1649360 GCGCGGCCCGCGGGAGGGAGGGG + Intronic
1142836769 17:2593541-2593563 GGGCGCCGGGAGCGGAGGAGGGG - Intronic
1142904032 17:3031095-3031117 GGGCTCCCCGAAGGAGGCAGGGG + Intronic
1143448045 17:7020153-7020175 GGGCGGTGGGAGGGAGAGAGGGG + Intergenic
1143642970 17:8210148-8210170 GGGCGCAGGGACGGAGGGAAGGG + Intronic
1144404469 17:14939488-14939510 AGGGGGCGAGAGGGAGGGAGAGG + Intergenic
1144724719 17:17496189-17496211 AGGGGCCGCGAGGGCGGGCGCGG + Exonic
1144727997 17:17511410-17511432 GGTCCCCCCGAGGGAGGAAGTGG - Intronic
1144835037 17:18152189-18152211 GAGGGCCAGGAGGGAGGGAGGGG + Intronic
1145110308 17:20156274-20156296 GGGCGCCTGGAGGGGGGGTGGGG - Intronic
1145205660 17:20983979-20984001 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1145904577 17:28509194-28509216 GGGCACAGAGAGGGAGGGAGGGG - Intronic
1145925644 17:28644934-28644956 CGGCGGCGGGAGGGAGGGGGCGG - Intronic
1146054103 17:29572730-29572752 GGGCGACGCGAGGTGGGGCGGGG - Intronic
1146176266 17:30668101-30668123 CGGCGGCCCCAGGGAGGGAGGGG + Intergenic
1146349721 17:32084211-32084233 CGGCGGCCCCAGGGAGGGAGGGG + Intergenic
1146371004 17:32265776-32265798 GGGCGGCGCGCGGGCGGGGGCGG - Intergenic
1146762404 17:35490048-35490070 CGGCGCCGCTTTGGAGGGAGAGG - Intronic
1146958100 17:36948940-36948962 GGGAGGCGCGCGGGAGGGGGCGG - Exonic
1147249465 17:39144387-39144409 GGGCAGGGCGAGGGATGGAGAGG + Intronic
1147313114 17:39606609-39606631 GGGCGCCCCGCGGGCGGGAAGGG + Intronic
1147742266 17:42676106-42676128 GGGCCCAGCGGGGAAGGGAGAGG + Intronic
1147742532 17:42677042-42677064 GGGGGCCCCCCGGGAGGGAGGGG - Intergenic
1147963177 17:44179981-44180003 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1147984644 17:44298435-44298457 GGGCCCTGGGAGGGAAGGAGTGG - Intergenic
1148211886 17:45813551-45813573 GGGGGCCAGGAGGGAGGGGGAGG + Intronic
1148675363 17:49441757-49441779 GGCTGCAGGGAGGGAGGGAGAGG - Intronic
1148782332 17:50129301-50129323 GGGCGTCGGGCGGGAGGGAGGGG + Intronic
1148878605 17:50707815-50707837 GGGCGGCCCGCGGGAGGGAGCGG - Exonic
1149865786 17:60150229-60150251 GGGGGCCGCGAGGGTGCGGGAGG + Intronic
1149908720 17:60550813-60550835 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1150675601 17:67244620-67244642 GCCCTCCGCGGGGGAGGGAGGGG + Intronic
1150792278 17:68208141-68208163 GGGCGCCGTGGGGCAGGGGGCGG - Intergenic
1150983374 17:70169031-70169053 GGGCTCCGGCAGAGAGGGAGTGG + Intronic
1151417971 17:73979045-73979067 GGTAGCAGGGAGGGAGGGAGTGG + Intergenic
1151606767 17:75142568-75142590 GGGAGGGGAGAGGGAGGGAGAGG + Intronic
1151623534 17:75262011-75262033 GGGCGCTGCGAGGAAGGAAGGGG + Intronic
1152107884 17:78341675-78341697 GTGCGGCGCTGGGGAGGGAGGGG + Intergenic
1152581196 17:81166247-81166269 GAGCGGCGCGGGGGAGGGGGGGG + Intergenic
1152589715 17:81205461-81205483 GGGCGGCGCGGGGGTAGGAGGGG + Intronic
1152697413 17:81804061-81804083 CGGCCCCGCGGGGGTGGGAGCGG - Intergenic
1152738510 17:82008907-82008929 GGCCGGGGCCAGGGAGGGAGTGG + Intronic
1152748643 17:82052475-82052497 GGGACCCCCGAGCGAGGGAGGGG + Intronic
1152758711 17:82097718-82097740 GGACGCCGCGAGGGAGGAACGGG - Intronic
1152801798 17:82334103-82334125 GGCCGCGGGGAGGGAGGGCGGGG + Intergenic
1152904537 17:82963033-82963055 GGGCGCAGGGAGAGGGGGAGGGG + Intronic
1153078339 18:1191812-1191834 GAGCACCGCGAGGGTGGGAAGGG + Intergenic
1154001834 18:10488164-10488186 AGGGGCTGGGAGGGAGGGAGAGG - Exonic
1154294067 18:13134718-13134740 GGGCGCCACGGAGCAGGGAGCGG + Intergenic
1154409832 18:14132462-14132484 GCGCGCAGCCAGGGAGGAAGGGG - Intronic
1155654418 18:28177402-28177424 GGAAGCCGCGAGGGATGCAGCGG + Exonic
1155654536 18:28177855-28177877 GGGCGGCGCGCGCGAGTGAGCGG - Intergenic
1155966068 18:32036621-32036643 GGGAGAGGGGAGGGAGGGAGGGG + Intronic
1157612001 18:48962938-48962960 GGGACGCGGGAGGGAGGGAGAGG - Intergenic
1157794131 18:50559711-50559733 GGGCTCCGTCCGGGAGGGAGGGG - Intergenic
1159343622 18:67169410-67169432 GGGAGGGGAGAGGGAGGGAGAGG + Intergenic
1160499323 18:79394488-79394510 GGGCGCCGGGAGGGGAGGAGGGG - Intergenic
1160501740 18:79404768-79404790 GCGCACAGCGAGTGAGGGAGTGG + Intronic
1160566790 18:79790921-79790943 GGGGGCAGGGAGGGAGAGAGAGG - Intergenic
1160567864 18:79798243-79798265 GGGCGCTGAGCGGGAGGGGGAGG - Intergenic
1160592114 18:79950914-79950936 GGGCGCTGCGATGGAGGCCGAGG - Exonic
1160765801 19:807119-807141 GGCCCCCGCGAGGGAGGGCCAGG - Intronic
1160844900 19:1161898-1161920 GGGAGCCGCGGGGGGGGGGGGGG + Intronic
1160859253 19:1230766-1230788 GGGCGGGGCGGGGGTGGGAGAGG + Exonic
1160939943 19:1615530-1615552 GGGCGCCGGGAGGGGGCCAGAGG + Intronic
1160948036 19:1652441-1652463 GGGCCACGCGGGGGTGGGAGGGG - Intronic
1160999844 19:1905185-1905207 GGGCGGCGGGAGGGGAGGAGAGG - Intergenic
1161002491 19:1917863-1917885 GGGCTCCCCGAGGGAGGGAGTGG + Intronic
1161026246 19:2038665-2038687 GGGCGGCGCGAGGCAGGACGTGG + Exonic
1161029395 19:2050861-2050883 GGGCCCCGCCAGCGGGGGAGGGG + Exonic
1161205011 19:3036373-3036395 GGGAGCCGGCAGGGAGGGAGCGG - Intronic
1161388072 19:4007534-4007556 GGTCGCCGCGAGCGGGGGGGGGG + Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162153418 19:8661028-8661050 GGGGGACGGAAGGGAGGGAGAGG - Intergenic
1162156123 19:8679115-8679137 GGGGGCAGCCAGGGAGAGAGAGG - Intergenic
1162315573 19:9936394-9936416 AGGCGCCGCTAGGGCGGGCGGGG - Exonic
1162401375 19:10448813-10448835 GGAGGCTGAGAGGGAGGGAGGGG - Intronic
1162578529 19:11513593-11513615 GGGGGAGGAGAGGGAGGGAGGGG + Intronic
1162746551 19:12801852-12801874 GCACGGCGCGGGGGAGGGAGCGG + Exonic
1162798410 19:13098272-13098294 GGGCGCCCCGAGGGTGGGTGGGG - Intronic
1162886684 19:13702739-13702761 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1162948518 19:14057502-14057524 GAGCCCCGCGGAGGAGGGAGGGG - Intronic
1163027044 19:14518477-14518499 CGGCGCCGCGGGGGCGGGCGGGG - Intronic
1163358337 19:16829552-16829574 GGGTTCCCCGAGGGAGGGCGGGG - Intronic
1163906095 19:20150745-20150767 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1164120620 19:22261978-22262000 TGGGGCCGGGAGGGAGAGAGGGG + Intergenic
1164179403 19:22806588-22806610 CGGGGCCGGGAGGGAGAGAGGGG - Intergenic
1164191900 19:22925486-22925508 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1164270541 19:23668560-23668582 GGGCGCCGTGGAGCAGGGAGCGG + Intronic
1164577283 19:29412995-29413017 GGGGGCCTGGAGGCAGGGAGGGG - Intergenic
1164639092 19:29811847-29811869 GGGCGGGGCGAGGGACGGGGCGG + Intergenic
1164653348 19:29901738-29901760 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1165129169 19:33621691-33621713 GGCGGCCGCGGGGGTGGGAGCGG - Intergenic
1165531368 19:36404733-36404755 GGGCATTTCGAGGGAGGGAGAGG - Intronic
1165894584 19:39133896-39133918 GGGCGCAGTGAGGGAGGGAAGGG - Intronic
1165994511 19:39834194-39834216 GGGAGCGGAGAGGGAGGGATGGG - Intronic
1166261430 19:41644209-41644231 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1166288170 19:41845206-41845228 AGGGGGCGCGAGGGCGGGAGGGG - Intronic
1166288184 19:41845232-41845254 GGGGCCCGCGAGGCAGGGAAGGG - Intronic
1166294632 19:41883054-41883076 GGGCGCAGCGGGGAAAGGAGGGG + Intergenic
1166304258 19:41928601-41928623 CGGCGGCGCGGGGGAGGGGGCGG + Intronic
1166304978 19:41932449-41932471 GGAGGCAGGGAGGGAGGGAGAGG + Intergenic
1166677413 19:44748475-44748497 GGCCTCGGCGGGGGAGGGAGAGG - Intronic
1166750697 19:45162791-45162813 GAGCACGGGGAGGGAGGGAGTGG + Intronic
1166780717 19:45341050-45341072 GGGCGGGGCCTGGGAGGGAGAGG + Intronic
1167040605 19:47020781-47020803 GGGCGGCGCGGGGGAGGCGGCGG + Intronic
1167391848 19:49200477-49200499 GGGTGGGGCCAGGGAGGGAGTGG + Intronic
1167768988 19:51502013-51502035 GGGCACTGAGAGGGAGGCAGTGG - Intergenic
1168069842 19:53943219-53943241 GGCCCCGTCGAGGGAGGGAGGGG + Exonic
1168182582 19:54672177-54672199 GGGGGTCTCAAGGGAGGGAGAGG + Intronic
1168465157 19:56595595-56595617 GGCCGGGGCCAGGGAGGGAGAGG + Intronic
925171057 2:1750640-1750662 GGGGGGAGGGAGGGAGGGAGGGG - Intergenic
925179699 2:1809046-1809068 GGGTGCCACGAGGGCTGGAGGGG + Intronic
925929092 2:8693462-8693484 GGGCGGCGGGAGGATGGGAGCGG + Intergenic
926684082 2:15685132-15685154 AGGTGCCGCGGGGCAGGGAGAGG - Intergenic
926828813 2:16937263-16937285 GGACGGAGGGAGGGAGGGAGGGG + Intergenic
926948405 2:18214200-18214222 GGGCACCGCGTAGGAGTGAGAGG - Intronic
927709047 2:25313987-25314009 GGGCGCCGGGAGGCAGGCTGGGG + Exonic
927824614 2:26299304-26299326 GTGCGCCGCAAGGGAGGAAATGG + Intergenic
927863972 2:26577098-26577120 GAGCGCCAAGATGGAGGGAGAGG - Intronic
928101288 2:28438955-28438977 GGGAGCGGTGAGGGAGGGAGGGG - Intergenic
929756313 2:44768551-44768573 GGGGGCCACGCTGGAGGGAGCGG + Intronic
932112442 2:69013368-69013390 GGGAGTTGCGAGGGAGCGAGGGG + Exonic
932620897 2:73264498-73264520 GCCCGCCCCGAGGGAGGCAGTGG - Exonic
933109489 2:78379201-78379223 GGGGGGAGGGAGGGAGGGAGAGG + Intergenic
933638279 2:84731146-84731168 GGGAGCAGGAAGGGAGGGAGTGG - Intronic
934176791 2:89584308-89584330 GGGCGTGGCGGGGGAGGGTGGGG + Intergenic
934287098 2:91658668-91658690 GGGCGTGGCGGGGGAGGGTGGGG + Intergenic
934704651 2:96468509-96468531 GGGAGCTGGGAGGGAAGGAGAGG - Intergenic
936234609 2:110732480-110732502 GGGCGGGGCCGGGGAGGGAGGGG + Intergenic
936545979 2:113393780-113393802 GAGCGCCGCCAGGGAGGCAGCGG + Intergenic
936713880 2:115162309-115162331 CGGCCCACCGAGGGAGGGAGAGG + Intronic
937395323 2:121530077-121530099 GGGGGCTGCGGGGGAGGGCGGGG + Intronic
937919700 2:127120535-127120557 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
938406367 2:131035274-131035296 GGGCGCCGCGCCGGGGTGAGTGG + Intronic
939153843 2:138501851-138501873 GGGCTGCGCGGGGGCGGGAGTGG + Exonic
941905425 2:170714052-170714074 GTGAGCCGCCAGGGAGGGATGGG + Exonic
941951440 2:171160645-171160667 GGGAGAAGCGAGGGAGCGAGCGG + Exonic
942451089 2:176108170-176108192 GGGGGCCGCGGGGGAGGGGGGGG + Intronic
945119490 2:206443505-206443527 AGGCGGCGCGCGGGAGCGAGCGG - Intergenic
945238363 2:207653627-207653649 GGAGGCAGAGAGGGAGGGAGAGG + Intergenic
946295689 2:218782032-218782054 GGGAGGAGCGAGGGAGCGAGCGG + Exonic
946322568 2:218962181-218962203 GGGCCCCGGGAGGGAGGGAGTGG + Intergenic
946376544 2:219313104-219313126 GGGCGCCGTGAAGAAGGGGGCGG - Intergenic
947188154 2:227472731-227472753 GGGCGCGGCGTGGGAGGCTGCGG + Intronic
947372868 2:229466326-229466348 GGGCGAGGTTAGGGAGGGAGAGG - Intronic
947650256 2:231780862-231780884 GGGCGTCCTGAGGGAGGAAGGGG - Intronic
947792474 2:232876127-232876149 GGGCGGGGCGGGGGAGGGAGGGG + Intronic
947992446 2:234497611-234497633 CCGCGGCGCGAGGGTGGGAGGGG - Intergenic
948393324 2:237627545-237627567 TGACGCCGCGGCGGAGGGAGGGG + Intergenic
948645189 2:239400344-239400366 GGCCGCCGGGAGTGAGGGCGGGG - Intronic
948660105 2:239501738-239501760 GGGAGGGGCAAGGGAGGGAGAGG + Intergenic
948710087 2:239819975-239819997 GGGAGTCCCCAGGGAGGGAGTGG + Intergenic
948871946 2:240805096-240805118 GGGAGAGGGGAGGGAGGGAGAGG + Intronic
949031746 2:241800352-241800374 GGGCACTTCGAGGGAGGGGGTGG + Intronic
1169061527 20:2663867-2663889 GGGAGCAGCGAGGAAGGGACAGG + Intronic
1169262391 20:4148608-4148630 GGCCCCTGCTAGGGAGGGAGGGG + Intronic
1169262540 20:4149047-4149069 GGCCGCCGCGAGAGGGTGAGGGG + Intronic
1170226287 20:13995277-13995299 GGGCGGAGCCAGGGAGCGAGGGG - Intronic
1170226295 20:13995298-13995320 GGGCGGAGCCAGGGAGCGAGGGG - Intronic
1171150419 20:22822409-22822431 GGGCCCAGTGAGGAAGGGAGGGG + Intergenic
1171223200 20:23420479-23420501 GGGCCCCGCCGGGGAGGGGGCGG - Intronic
1171388559 20:24786565-24786587 GGGGGCAGTGAGGGAGGAAGGGG - Intergenic
1171468944 20:25354363-25354385 GGGGGCAGGGAGGCAGGGAGGGG + Intronic
1172350070 20:34231372-34231394 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1172474526 20:35226879-35226901 GGGCGCCGCGCGGGCGGCGGCGG + Exonic
1173848186 20:46201149-46201171 GGGCGCCGCGAGGCTGCGCGCGG + Intronic
1175748083 20:61475533-61475555 GGGGGCAGGGAGAGAGGGAGGGG - Intronic
1175927045 20:62476059-62476081 GGGCGCGGGGAGGGAAGGGGCGG - Intergenic
1175962821 20:62645767-62645789 TGGCTGCGCGTGGGAGGGAGAGG - Intronic
1175997151 20:62817009-62817031 GGGCGGCGCGCGGGCGGGCGGGG - Intronic
1176005659 20:62861184-62861206 CGGCGCCGCCAAGGAGGGCGCGG - Exonic
1176030104 20:63007582-63007604 GGGCTCCCCGGGGGTGGGAGGGG + Intergenic
1176119280 20:63446724-63446746 GTGAGCCCCGAGGGAGGGCGGGG - Intronic
1176131777 20:63499332-63499354 AGGCGGCGGGAGGGAGGGACCGG + Intergenic
1176162167 20:63653476-63653498 GGGCGCGGCGGGAGAGAGAGAGG + Intergenic
1176199999 20:63855805-63855827 GGGCGCAGGGAGGGAGGGCTGGG + Intergenic
1176237294 20:64059534-64059556 GGGTGCCCAGAGGAAGGGAGAGG - Intronic
1176548150 21:8210365-8210387 GGGCGCCGAGAGGCAAGGGGCGG - Intergenic
1176556043 21:8254573-8254595 GGGCGCCGAGAGGCAAGGGGCGG - Intergenic
1176567081 21:8393400-8393422 GGGCGCCGAGAGGCAAGGGGCGG - Intergenic
1176574980 21:8437610-8437632 GGGCGCCGAGAGGCAAGGGGCGG - Intergenic
1176863390 21:14027388-14027410 GCGCGCAGCCAGGGAGGAAGGGG + Intergenic
1177431688 21:20998262-20998284 GGGCGCGGCGAGGGGAGGTGCGG - Intergenic
1177674379 21:24277325-24277347 GGGAGGGGAGAGGGAGGGAGTGG - Intergenic
1178598602 21:33976644-33976666 GGGCACAGCGAGGGAGACAGAGG - Intergenic
1179891644 21:44338700-44338722 AGGAGCCGCGGGTGAGGGAGGGG - Intronic
1180421104 22:12815607-12815629 GGGCGCATCGAGGGAGGGCAGGG - Intergenic
1181046285 22:20215832-20215854 GGTCACGGCGGGGGAGGGAGGGG + Intergenic
1181563048 22:23716893-23716915 GGGACCCGCGAGGGCCGGAGCGG - Intergenic
1181871587 22:25903476-25903498 GGGCGCTGTGAGGGACGGTGGGG + Intronic
1182972866 22:34593886-34593908 GGGGGGAGGGAGGGAGGGAGGGG + Intergenic
1183007634 22:34916596-34916618 GGATGCAGGGAGGGAGGGAGGGG + Intergenic
1183318542 22:37149794-37149816 AGGGGCCGGGAGGGAGGCAGGGG + Intronic
1183492447 22:38123724-38123746 GGGGGCAGGGAGGAAGGGAGAGG + Intronic
1183841644 22:40502749-40502771 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1183845097 22:40536403-40536425 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1184046715 22:41976726-41976748 GGGCGCCGCGGGAAGGGGAGGGG + Intronic
1184276523 22:43412090-43412112 GCGCGCACCGAGGGAGGCAGGGG - Intronic
1184523137 22:45007534-45007556 GGGCGCGGCGCGGGCGGGGGCGG + Intronic
1184567145 22:45298852-45298874 TGGCGCCCCGGGGGAGGAAGGGG + Intergenic
1184683413 22:46085143-46085165 AGGCGGGCCGAGGGAGGGAGTGG + Intronic
1184722142 22:46321032-46321054 GGAGGCGGCGAGGGAGAGAGAGG + Intronic
1185055321 22:48576040-48576062 GGGCGGCGCGGGGGGGGGGGGGG - Intronic
1185128557 22:49025013-49025035 GGGCTCAGCCAGGGAGGGAGCGG - Intergenic
1185229070 22:49670234-49670256 GGGCGCCGCGGAGCAGGGGGCGG + Intergenic
1185285790 22:49999526-49999548 AGGGGCCGCGCGGGAGGGCGGGG + Intronic
1203253029 22_KI270733v1_random:126665-126687 GGGCGCCGAGAGGCAAGGGGCGG - Intergenic
1203261084 22_KI270733v1_random:171746-171768 GGGCGCCGAGAGGCAAGGGGCGG - Intergenic
950902985 3:16513651-16513673 GGGCGCAGCGAGCGAGAGCGCGG - Exonic
951013746 3:17705943-17705965 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
951803882 3:26624591-26624613 GGGCGGAGCGAGGGAGTGGGGGG + Intronic
951804424 3:26629181-26629203 GGACGCAGGGAGGGAGGGGGAGG - Intronic
952252988 3:31672367-31672389 GGGGGGCAGGAGGGAGGGAGAGG + Intronic
953027698 3:39154148-39154170 GGGAGCGGGGAGGCAGGGAGCGG + Intronic
953526241 3:43691636-43691658 GGGTGCCGGGAAGGAGGGAGGGG + Intronic
953947760 3:47163969-47163991 GGGCGACGCGGGGGAGGGGAGGG + Intergenic
954080512 3:48210827-48210849 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
954313827 3:49790170-49790192 GGGCGGGGAGAGGGAGAGAGGGG - Intergenic
954479864 3:50788781-50788803 GAGCGCAGGGAGGGAGGCAGGGG + Intronic
954632760 3:52056216-52056238 GGGCGCGGCGACGGGGGCAGGGG - Exonic
954672631 3:52298952-52298974 GGGGGCAGCGGGAGAGGGAGAGG + Intergenic
955107352 3:55911024-55911046 GAGCGCAGGGAGGGAGGGAAAGG - Intronic
955297212 3:57746921-57746943 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
955887884 3:63619804-63619826 GGGTGCAGGGTGGGAGGGAGAGG - Intergenic
956658987 3:71581648-71581670 GCGCGCGGCGAGCGAGCGAGCGG - Intronic
956761301 3:72447209-72447231 CGGCGCCGCGAGGGCGGAGGCGG + Intergenic
957078775 3:75620307-75620329 GGGTGGGGGGAGGGAGGGAGGGG - Intergenic
957816267 3:85301376-85301398 GGGAGAGGAGAGGGAGGGAGAGG + Intronic
958019404 3:87979039-87979061 GGGGGGAGGGAGGGAGGGAGGGG + Intergenic
958814471 3:98901206-98901228 TGGAGCAGGGAGGGAGGGAGCGG + Exonic
959042487 3:101438832-101438854 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
959419600 3:106112670-106112692 GAGCGCCGCCGGGGAGGCAGCGG - Intergenic
960684759 3:120285280-120285302 GGGCGGCGCCAGGGAGGGGCGGG - Intergenic
961140283 3:124550285-124550307 GGGAGCCGGAAGGGAGGAAGAGG + Intronic
961340303 3:126213041-126213063 GGGCGCCCCCAGGAAGGGACAGG + Intergenic
961537187 3:127577289-127577311 GGGCCCCGAGAGGGAGGGCCAGG - Intronic
961716400 3:128860383-128860405 GGGGGCCGGGCAGGAGGGAGGGG + Intergenic
961958125 3:130825387-130825409 GGGAGGAGGGAGGGAGGGAGGGG + Intergenic
963038677 3:141052775-141052797 GGGCTCTGGGAAGGAGGGAGGGG + Intronic
963236767 3:142963762-142963784 GGGCGCACCGAGGAAGGGCGGGG + Intergenic
963264694 3:143228637-143228659 TGGCCCCCCGAGGGAGGAAGTGG + Intergenic
963673463 3:148280598-148280620 GGGCGCCGTGGAGCAGGGAGTGG + Intergenic
964790421 3:160449589-160449611 GGGCGCGACGATGGAGGGAGTGG - Intronic
965173083 3:165293881-165293903 GGGAGGAGAGAGGGAGGGAGGGG + Intergenic
965881723 3:173395870-173395892 GGGCGGGGAGAGGGAGGCAGCGG + Intergenic
966182123 3:177197284-177197306 GGGCGCCGGGCGGGCGGGGGCGG + Intronic
966359441 3:179119456-179119478 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
966712037 3:182980734-182980756 GGGCGCGGCGGGGGAGGGGCGGG + Intronic
966866059 3:184259828-184259850 GGGAGCCGTGCGGGAGGGGGCGG + Exonic
966936240 3:184711677-184711699 TGGCGCCGGGAGGGAGGAGGGGG - Exonic
967033629 3:185631444-185631466 GGGAGGGGAGAGGGAGGGAGGGG - Exonic
967033640 3:185631465-185631487 GGGAGGGGGGAGGGAGGGAGGGG - Exonic
967217260 3:187220985-187221007 GGGCGCTGCCAGCCAGGGAGTGG - Intronic
968292239 3:197547720-197547742 AGGGGCCTCCAGGGAGGGAGAGG - Intronic
968502221 4:956090-956112 GGGAGCCGCTGGGAAGGGAGGGG - Intronic
968583117 4:1403995-1404017 GGGCGGCGGGAGGGAAGGACAGG - Intronic
968661806 4:1801756-1801778 GGGCGGCGCGGGGGTGGGGGCGG + Intronic
968674661 4:1871187-1871209 GGGGGCCGCGCGGGCGGGCGGGG - Intergenic
968938216 4:3624565-3624587 GGGAGCAGCGTGGGAGGGAGAGG + Intergenic
969114549 4:4862987-4863009 GGCCGCCGAGAGGGAAGGAGAGG - Exonic
969389085 4:6877313-6877335 GGGCACCACGAAGGCGGGAGCGG + Intronic
969394200 4:6909982-6910004 GCGGGCCGCGAGGGAGGGCAGGG + Intronic
969514046 4:7636710-7636732 GGGAGGCGTGAGGAAGGGAGGGG - Intronic
969531242 4:7732376-7732398 AGGGGCCGGGAGGGAGTGAGAGG + Intronic
969582551 4:8073538-8073560 GGGAGGGGTGAGGGAGGGAGAGG + Intronic
969857948 4:10015034-10015056 GAGAACCCCGAGGGAGGGAGGGG + Intronic
970456205 4:16226516-16226538 GGGCGGGGCGAGGCGGGGAGGGG - Exonic
970522401 4:16898815-16898837 GGGAGGAGGGAGGGAGGGAGGGG + Intergenic
971351938 4:25862990-25863012 GGGGGCGGCGACGGCGGGAGCGG - Intronic
972782867 4:42301195-42301217 GGGCCTCGGGAGGGAAGGAGGGG + Intergenic
973764252 4:54149341-54149363 GGGCGCCGCGGAGCAGGGGGTGG + Intronic
975567901 4:75779207-75779229 GGGAGGCCCGAGGGAGGGAGGGG - Intronic
978400912 4:108329669-108329691 GGGAGGAGGGAGGGAGGGAGGGG + Intergenic
978565482 4:110077018-110077040 GGCCGCAGCGAGGCTGGGAGAGG + Intronic
979033177 4:115678533-115678555 GGGCGCCGCAGAGCAGGGAGCGG + Intergenic
980130527 4:128812167-128812189 GGACGCCGCTGCGGAGGGAGCGG + Intronic
982616113 4:157637790-157637812 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
982875754 4:160647191-160647213 GGGCTACAAGAGGGAGGGAGAGG + Intergenic
983834189 4:172369505-172369527 GGGCGCCGCGGAGCAGGGGGTGG + Intronic
983879075 4:172912647-172912669 GGCCGCAGCGAGGGTGGGGGAGG + Intronic
983919785 4:173333768-173333790 GGGCGCGGGCAGGGCGGGAGCGG - Intronic
984830226 4:183966059-183966081 GGGGGCAGGGAGGGAGGGAGAGG + Intronic
985087347 4:186326340-186326362 GGGAACCACGAGTGAGGGAGGGG - Intergenic
985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG + Intronic
985939342 5:3121957-3121979 GGGCCGAGCGAGGGAGGAAGGGG - Intergenic
986043260 5:4013269-4013291 GGGGACCTGGAGGGAGGGAGGGG - Intergenic
986773548 5:10994450-10994472 GGGGGCCGGGAAGGAGGAAGGGG + Intronic
987373921 5:17217478-17217500 GGGCGCCGGGCTGGAGGGAGGGG + Intronic
989103443 5:37840099-37840121 GGGCCCCGGGAGGGAGGGGTCGG + Intergenic
989588181 5:43089138-43089160 GGGAGACGAGAGGGAGGGGGAGG + Intronic
990545215 5:56815526-56815548 GGCCCCTGCGAGGGAGGGAGGGG - Intergenic
992048917 5:72925819-72925841 GGGCGCCGCGGAGCAGGGGGCGG - Intergenic
992102372 5:73419761-73419783 GGGCGGCCCGGGGGAGGGCGAGG + Intergenic
992373706 5:76171039-76171061 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
992487452 5:77210443-77210465 GGTGGGAGCGAGGGAGGGAGGGG + Intronic
997207621 5:132059399-132059421 TGGCCCCGGGTGGGAGGGAGAGG - Intergenic
998117588 5:139549672-139549694 GGGCGCCGCGGAGCAGGGGGTGG - Intronic
998150777 5:139756336-139756358 GGCCGCGGCGCTGGAGGGAGTGG + Intergenic
998157662 5:139795792-139795814 GGACGGCAGGAGGGAGGGAGCGG - Intergenic
998364415 5:141619283-141619305 GGGCGCTGCGTGGGAGCCAGAGG - Intergenic
998406049 5:141875506-141875528 GGGGGCCGCGAGGGTGGGGGAGG - Intronic
999300223 5:150486193-150486215 GGGCACCGGGAGGGAGCGGGAGG + Intronic
999318821 5:150601014-150601036 GGGGGGCGGGCGGGAGGGAGGGG - Intergenic
999348591 5:150845755-150845777 GGGCGCCGTGGAGCAGGGAGCGG - Intergenic
1000329138 5:160193928-160193950 GGGCGCCGTGGGGCAGGGGGCGG + Intronic
1000363335 5:160468093-160468115 CGGCACAGCGAGGGAGGAAGAGG - Intergenic
1000985233 5:167858809-167858831 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1001089422 5:168726435-168726457 GGAGGCAGGGAGGGAGGGAGAGG + Intronic
1001556564 5:172641243-172641265 GGGAGCCGGGAGGGAGGCGGCGG - Intergenic
1001981038 5:176037180-176037202 GGGTGCAGAGAGGGAGGGGGAGG + Intergenic
1002001674 5:176199670-176199692 GGGCGCCACTAGGCAGGGATAGG + Intergenic
1002029369 5:176416547-176416569 GGGCGCCGCGGCGGGAGGAGCGG + Exonic
1002236422 5:177806886-177806908 GGGTGCAGAGAGGGAGGGGGAGG - Intergenic
1002341426 5:178518839-178518861 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1002591098 5:180292056-180292078 GGGCGCCGCGGCGGCGGCAGCGG - Exonic
1002670350 5:180861363-180861385 CGCCGGCGGGAGGGAGGGAGGGG + Intergenic
1003153189 6:3570088-3570110 GGGAGAGGAGAGGGAGGGAGGGG - Intergenic
1003506637 6:6745748-6745770 GGGCGCCGTGGAGCAGGGAGCGG + Intergenic
1003518451 6:6837065-6837087 GGGAGAGGGGAGGGAGGGAGGGG + Intergenic
1004387934 6:15188426-15188448 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1004607305 6:17206476-17206498 GGGGGCGGGGAGGGAGGGGGTGG + Intergenic
1004627869 6:17393765-17393787 GGGCCCGGCGAGGCGGGGAGGGG + Intronic
1004903215 6:20212493-20212515 GGGCGCGGAGAGGAAGGGAGCGG - Intergenic
1005348185 6:24910467-24910489 GGGCCCCGGGAGTCAGGGAGGGG - Intronic
1005751257 6:28885166-28885188 GGGCGCCGCGGAGCAGGGGGCGG + Intergenic
1006492116 6:34396959-34396981 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1006499386 6:34448295-34448317 GGGTGGGGCGAGGGAGGGAAAGG + Intergenic
1006535669 6:34696852-34696874 GGGCGCGGCGCGGGAGGAGGCGG - Intronic
1006670123 6:35725238-35725260 GGGGGCCTCGCGGCAGGGAGGGG - Intronic
1007183500 6:39947939-39947961 GGGTGTAGGGAGGGAGGGAGGGG + Intergenic
1007674442 6:43581589-43581611 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1007739511 6:44002274-44002296 CGGCCCCGCGGGGGAGGGCGTGG - Intronic
1007957402 6:45929992-45930014 GGGGGCTGGGAGGGAGGAAGGGG + Intronic
1009382782 6:63053334-63053356 GGAGGCAGCGAGGGTGGGAGAGG + Intergenic
1010743352 6:79533348-79533370 GGGGGGAGCGAGGGAGTGAGGGG + Intronic
1011405437 6:87010844-87010866 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1011870035 6:91881925-91881947 GGGCGCCGTGAAGCAGGGGGTGG + Intergenic
1012106325 6:95164762-95164784 GGAGGGAGCGAGGGAGGGAGGGG - Intergenic
1013117538 6:107114676-107114698 GGGCGCCGCGATGGAGCGGCCGG - Intronic
1013143513 6:107364276-107364298 GGGCGCCGTGGAGTAGGGAGTGG + Intronic
1013418906 6:109948852-109948874 AGGCGGAGGGAGGGAGGGAGGGG + Intergenic
1014280857 6:119441333-119441355 GGGCGCCGTGAAGCAGGGGGCGG - Intergenic
1014551870 6:122798446-122798468 GGTGGCGGAGAGGGAGGGAGTGG - Intronic
1015333037 6:132003727-132003749 GGGCGCAGCAAGGGTGGGAAGGG - Intergenic
1015354031 6:132255897-132255919 GGGCGTGGAGAGGGAGAGAGGGG - Intergenic
1015476525 6:133664269-133664291 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1018234516 6:161710946-161710968 GGGAGAAGGGAGGGAGGGAGTGG - Intronic
1019057329 6:169232843-169232865 GGGCGCCCTGAGGTCGGGAGCGG - Intronic
1019368851 7:650372-650394 GTGAGCAGGGAGGGAGGGAGGGG - Intronic
1019472792 7:1230193-1230215 AGGGCCCGCGAGGGAGGGGGCGG + Intergenic
1019697310 7:2452727-2452749 GGGGGAGGGGAGGGAGGGAGTGG - Intergenic
1020034891 7:4958929-4958951 GTCCGCGGGGAGGGAGGGAGGGG - Intronic
1020107789 7:5430182-5430204 GGGAGCCGGCAGGGAGGGGGTGG - Intergenic
1020186577 7:5963369-5963391 GAGCGGGGAGAGGGAGGGAGGGG - Intronic
1020238448 7:6374415-6374437 GGGAGCGGCGCGGGCGGGAGCGG + Intergenic
1020238453 7:6374430-6374452 GGGAGCGGCGCGGGCGGGAGCGG + Intergenic
1020296339 7:6761405-6761427 GAGCGGGGAGAGGGAGGGAGGGG + Intronic
1020369606 7:7417521-7417543 GGGGGGAGGGAGGGAGGGAGGGG + Intronic
1020616642 7:10466464-10466486 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1020771667 7:12403600-12403622 TGGCGCCGCGTGGGCGGTAGAGG - Intronic
1020784384 7:12556193-12556215 GGGCGCCGCGGAGCAGGGGGCGG + Intergenic
1021872134 7:25017934-25017956 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1022282765 7:28927558-28927580 GGGGGCCGGGAGGGGAGGAGGGG + Intergenic
1022505873 7:30908415-30908437 GGGGGTGGGGAGGGAGGGAGGGG - Intergenic
1022629384 7:32070924-32070946 AGGCGCGGCCAGGGAGTGAGCGG - Intronic
1022924021 7:35042449-35042471 GGGCTTGGGGAGGGAGGGAGTGG - Intergenic
1023863847 7:44229577-44229599 GGAGGCCAGGAGGGAGGGAGGGG + Intronic
1023965992 7:44963270-44963292 GGGCCCCGAGAGGGAGGAGGGGG - Intronic
1023995629 7:45157632-45157654 GCGCGCCGGGTGGGAGGGATGGG - Intergenic
1024255608 7:47537947-47537969 GGGTGCGGTGAGGGAGGGATAGG - Intronic
1024962435 7:54991604-54991626 GGATGCCGTGTGGGAGGGAGAGG - Intergenic
1025052302 7:55741516-55741538 GGCCGCCATGAGGGAGGCAGAGG - Intergenic
1025129815 7:56369427-56369449 GGCCACCGTGAGGGAGGAAGTGG + Intergenic
1025130280 7:56371300-56371322 GGCCGCCATGAGGGAGGCAGAGG - Intergenic
1025130600 7:56372598-56372620 GGCCGCCATGAGGGAGGCAGAGG - Intergenic
1025130918 7:56373892-56373914 GGCCGCCATGAGGGAGGCAGAGG - Intergenic
1028198611 7:87934893-87934915 GGGTTCCGAGAGGGAGGGGGCGG + Intronic
1029249180 7:99223794-99223816 GGAGGGAGCGAGGGAGGGAGGGG + Intergenic
1029270610 7:99374854-99374876 GGGCGCCGCCTGGGAGTGAGCGG + Intronic
1029273339 7:99390021-99390043 GGGCGCCATGGGGGAGGGCGGGG + Intronic
1029412866 7:100426907-100426929 GGGAGAAGGGAGGGAGGGAGAGG - Intronic
1029491925 7:100875352-100875374 GGGCCCCGCTGGGGCGGGAGAGG + Intronic
1029506432 7:100966301-100966323 GGGCCCCGCGGGGGCGGGTGAGG - Intronic
1030115787 7:106061290-106061312 GTGGGACGCCAGGGAGGGAGAGG - Intergenic
1030215680 7:107042393-107042415 GGGCGCCGTGAAGCAGGGGGCGG + Intergenic
1030348144 7:108456013-108456035 GGGCGCCGAGAGGGAGCAGGGGG - Intronic
1030348249 7:108456462-108456484 GGGAGCGGAGAGGGCGGGAGCGG - Intronic
1032194220 7:129780298-129780320 AGGTGCCGCGAGGCGGGGAGGGG + Intergenic
1032283511 7:130524604-130524626 AGGCGCCAAGAGGGAGGGAGCGG + Intronic
1032284251 7:130528830-130528852 AGGCGCCAAGAGGGAGGGAGCGG + Intronic
1032709984 7:134452885-134452907 GGGAGCAGCGAGGCAGGGTGGGG + Intronic
1033406446 7:141074246-141074268 GGGTGCGGCGAGGGAAGGCGAGG + Exonic
1033657040 7:143381456-143381478 GGGCGCCGGGAGGGGGCGAGTGG + Intronic
1034612238 7:152381348-152381370 GGGGGCAGGGAGGGGGGGAGGGG + Intronic
1034895230 7:154872204-154872226 GGGAGCAGGGAGGCAGGGAGAGG - Intronic
1035127128 7:156616740-156616762 GGGCGCGGCGGGGGAGAGCGCGG - Intergenic
1035287395 7:157815069-157815091 GGGAGCAGCGCGGGAGGCAGTGG + Intronic
1035325462 7:158062898-158062920 GGGCGCCGCGGAGCAGGGGGCGG - Intronic
1035386528 7:158476541-158476563 AGACGCCGCTCGGGAGGGAGAGG + Intronic
1035508119 8:150626-150648 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1036426478 8:8649614-8649636 GGGAGCAGCGAGGCAGGGAGGGG - Intergenic
1036536883 8:9658337-9658359 GAGCGCCGCCTGGGAGGCAGCGG - Intronic
1037308502 8:17530296-17530318 GGGAGCCGGGACAGAGGGAGAGG + Intronic
1037811489 8:22089442-22089464 GGGCGCGGCCGGGGAGGCAGAGG - Intronic
1038036429 8:23690572-23690594 TGGCTCAGCCAGGGAGGGAGGGG + Intergenic
1038568170 8:28637014-28637036 GGGCGGGGAGAGGGAGGGAGCGG + Intronic
1038807951 8:30812293-30812315 GGGCGCCGCGGGGGCGAGTGCGG - Intronic
1039476434 8:37841592-37841614 GGGGGCCGCGGGAGAGGCAGGGG - Exonic
1039518319 8:38151145-38151167 GGGCCAGGCGAGGGATGGAGGGG + Exonic
1039591994 8:38757215-38757237 GGGTGGGGCGAGGGAGGGCGGGG - Intronic
1040399076 8:47029974-47029996 GGGGGGAGAGAGGGAGGGAGGGG + Intergenic
1040581764 8:48704249-48704271 GGGGGACAAGAGGGAGGGAGTGG - Intergenic
1041792507 8:61713796-61713818 GGGCGCCGGGGGGCAGGGGGAGG - Intronic
1042048805 8:64685164-64685186 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1042059631 8:64802608-64802630 GGAAGCAGGGAGGGAGGGAGGGG + Intergenic
1042164640 8:65933755-65933777 GGGAGGCACTAGGGAGGGAGAGG + Intergenic
1042591771 8:70403660-70403682 CGGGGCCGCGAGGGCGGGCGGGG - Intronic
1043073296 8:75665497-75665519 GGGCGCCGTGGAGCAGGGAGCGG + Intergenic
1044306466 8:90645935-90645957 GGGCGCCGCGGCGGAGGGGCTGG - Exonic
1044660456 8:94590194-94590216 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1044698908 8:94949172-94949194 GGGCTGCGCGGGGAAGGGAGCGG + Exonic
1045305999 8:100957216-100957238 GGGCGCCGTGGAGCAGGGAGTGG + Intergenic
1046661152 8:116949781-116949803 GGGCGCCGCGGAGCAGGGGGCGG + Intergenic
1047347973 8:124046929-124046951 TGGGGCCCAGAGGGAGGGAGTGG - Intronic
1047687109 8:127315859-127315881 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1047848281 8:128827163-128827185 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1049159101 8:141086132-141086154 GGTCCCCACGAGGGAGGGTGGGG + Intergenic
1049405469 8:142450147-142450169 GGGCGCAGCGAGGGTGGGAGGGG + Intronic
1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG + Intergenic
1049532293 8:143160491-143160513 GGGCGCCGCGAGGGAGGGAGCGG - Intronic
1049613201 8:143565329-143565351 GGGCACCATGAGGGAGGGGGAGG + Intergenic
1049762144 8:144336515-144336537 GGGGGCGGAGAGGGGGGGAGCGG + Intergenic
1049944464 9:580803-580825 GGGCGCCGCGGAGCAGGGGGCGG + Intronic
1052757063 9:32551984-32552006 GGGAGGCGTGGGGGAGGGAGCGG + Intronic
1053230096 9:36400895-36400917 GGGCGCGGCGGGGCGGGGAGGGG - Intronic
1053454982 9:38226950-38226972 GGGGGTCGGCAGGGAGGGAGGGG + Intergenic
1053457059 9:38241530-38241552 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1054452979 9:65413194-65413216 GGGAGCAGCGTGGGAGGGAGAGG - Intergenic
1056081049 9:83093816-83093838 AGGCGCCGAGAGCGAGCGAGGGG + Intergenic
1056541286 9:87573466-87573488 AGGAGCAGAGAGGGAGGGAGGGG + Intronic
1056659617 9:88534667-88534689 GGGCGCAGTGGGGGAGGGAGCGG + Intergenic
1056663681 9:88563473-88563495 GGGCGCAAGGAGGGTGGGAGTGG - Intronic
1057186337 9:93059200-93059222 GGGTGGCGCGGGGGCGGGAGGGG + Intronic
1057196059 9:93116027-93116049 GGGAGGAGGGAGGGAGGGAGGGG + Intergenic
1057379188 9:94553689-94553711 GGGCACCACGGGGGAGGGAGGGG - Intergenic
1057519821 9:95751894-95751916 GAGCTGCGAGAGGGAGGGAGGGG + Intergenic
1057565070 9:96160170-96160192 GGAGGGCGGGAGGGAGGGAGGGG + Intergenic
1057781914 9:98056972-98056994 GGGCGCCGGGAGGGGCGGGGCGG + Intronic
1057792025 9:98130801-98130823 GGGAGCCAGGAGGGTGGGAGGGG + Intronic
1058897384 9:109412180-109412202 GGGTGCAGGGAGGGAGAGAGAGG - Intronic
1059191798 9:112333724-112333746 GCGGGCCCCGAGGGAGGGCGGGG - Intergenic
1059210851 9:112513690-112513712 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1059965095 9:119605982-119606004 GGGCGGAGAGAGGGAGAGAGAGG - Intergenic
1060064770 9:120495043-120495065 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1060143711 9:121233134-121233156 GGGCTCCAAGAGGGAGGAAGAGG - Intronic
1060892867 9:127199521-127199543 GGGATCCTCGAGGGAGGCAGAGG - Intronic
1060892873 9:127199542-127199564 GGGATCCTCGAGGGAGGCAGAGG - Intronic
1060892879 9:127199563-127199585 GGGATCCTCGAGGGAGGCAGAGG - Intronic
1060892885 9:127199584-127199606 GGGATCCTCGAGGGAGGCAGAGG - Intronic
1060979926 9:127786009-127786031 CGGCGCCGCGAGGCCGGAAGTGG + Intronic
1061014884 9:127975872-127975894 GGGTCCCGGGAGGGAGGAAGAGG - Intronic
1061128215 9:128689750-128689772 GGGCGCCGGGCGGGGGGGCGCGG + Intronic
1061208089 9:129175951-129175973 GGCGGCCCCGGGGGAGGGAGGGG - Exonic
1061257341 9:129460416-129460438 GGGCGGAGGGAGGAAGGGAGGGG - Intergenic
1061262661 9:129488607-129488629 GCCGGCCGCGAGGGCGGGAGGGG - Intergenic
1061272171 9:129549897-129549919 GCGGACCGCGAGGGAAGGAGGGG + Intergenic
1061625545 9:131838876-131838898 GCGGGCCTCGAGGGAGTGAGTGG + Intergenic
1061853632 9:133429701-133429723 GGGAGCGGCGACGGAGGGACGGG - Intronic
1061984100 9:134119079-134119101 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1062084447 9:134641634-134641656 GGGCGCCGCGGGCGAGGGGGTGG - Intergenic
1062252413 9:135604962-135604984 GGAAGCAGGGAGGGAGGGAGAGG + Intergenic
1062333114 9:136053170-136053192 GGGCGCCGGGAGTGAGGGGCAGG - Intronic
1062362263 9:136193621-136193643 GGCCGCCGCGGGGAGGGGAGCGG - Intergenic
1062491643 9:136807885-136807907 GGGCGCCGCGAGGGCCGCGGGGG - Intergenic
1062527696 9:136984969-136984991 GGGCGAAGAGAGGGAGAGAGGGG - Exonic
1203469431 Un_GL000220v1:109812-109834 GGGCGCCGAGAGGCAAGGGGCGG - Intergenic
1203477252 Un_GL000220v1:153784-153806 GGGCGCCGAGAGGCAAGGGGCGG - Intergenic
1185459889 X:328986-329008 GGGGGCGGGGAGAGAGGGAGGGG - Intergenic
1185700697 X:2228163-2228185 GGGGGAAGGGAGGGAGGGAGGGG + Intronic
1186500041 X:10043818-10043840 CGGCGCCGAGAGAGAGAGAGAGG + Intronic
1187535924 X:20141715-20141737 GGGCGACACGAGGGAGCGCGCGG + Exonic
1187669523 X:21655886-21655908 GGACGACGAGAGGGAGGGAGAGG - Exonic
1187976705 X:24710086-24710108 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1189321502 X:40090254-40090276 CGGCGGCGGGAGGGACGGAGGGG + Intronic
1189339505 X:40193938-40193960 TAGCGCGGGGAGGGAGGGAGAGG + Intergenic
1190024575 X:46912228-46912250 CGGCGCCGCGGGTGCGGGAGCGG + Intergenic
1190905600 X:54724218-54724240 TGGAGCAGGGAGGGAGGGAGAGG - Intergenic
1191618321 X:63190352-63190374 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1192621071 X:72680824-72680846 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1193783684 X:85734026-85734048 GGGGGCAGCGAGGCTGGGAGAGG + Intergenic
1195036330 X:100973410-100973432 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1195923243 X:110002838-110002860 CGGCGCCGGGGAGGAGGGAGGGG + Intronic
1196404624 X:115348286-115348308 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1197872515 X:131073096-131073118 GCCCGACGTGAGGGAGGGAGAGG + Intronic
1199336048 X:146620079-146620101 GGGCTCCGCCAGGGAGGGAGGGG + Intergenic
1200068809 X:153517898-153517920 GGGCGCCGCCGGGGTGGGCGCGG + Intronic
1200117693 X:153776532-153776554 GGGCGGGGCGAGGCAGGGCGGGG + Intronic
1200117705 X:153776558-153776580 GGGCGGGGCGAGGCAGGGCGGGG + Intronic
1200117754 X:153776677-153776699 GGGCGGGGCGAGGCAGGGCGGGG + Intronic
1200169253 X:154060541-154060563 GGGTGGGGAGAGGGAGGGAGGGG + Intronic
1200173614 X:154097176-154097198 GGGGCGCGCGAGGGAGGGAGGGG + Intronic
1200181717 X:154154984-154155006 GGACTCCTCCAGGGAGGGAGTGG - Intronic
1200187366 X:154192098-154192120 GGACTCCTCCAGGGAGGGAGTGG - Intergenic
1200193015 X:154229238-154229260 GGACTCCTCCAGGGAGGGAGTGG - Intronic
1200198770 X:154267042-154267064 GGACTCCTCCAGGGAGGGAGTGG - Intronic
1200284294 X:154805543-154805565 GGGCGGAGCGAGGGCAGGAGTGG - Intronic
1200336292 X:155354249-155354271 GAGCTCCCGGAGGGAGGGAGGGG + Intergenic
1200350178 X:155486978-155487000 GAGCTCCCGGAGGGAGGGAGGGG - Intergenic
1200807140 Y:7444548-7444570 GGGAGAAGGGAGGGAGGGAGGGG + Intergenic
1200807149 Y:7444568-7444590 GGGAGAAGGGAGGGAGGGAGGGG + Intergenic