ID: 1049532641

View in Genome Browser
Species Human (GRCh38)
Location 8:143162137-143162159
Sequence CTGTGTGGGTGCCAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049532641_1049532651 0 Left 1049532641 8:143162137-143162159 CCCTCCACTTGGCACCCACACAG No data
Right 1049532651 8:143162160-143162182 AGCCCTCCGGGGAGCCAGGGTGG No data
1049532641_1049532649 -4 Left 1049532641 8:143162137-143162159 CCCTCCACTTGGCACCCACACAG No data
Right 1049532649 8:143162156-143162178 ACAGAGCCCTCCGGGGAGCCAGG No data
1049532641_1049532650 -3 Left 1049532641 8:143162137-143162159 CCCTCCACTTGGCACCCACACAG No data
Right 1049532650 8:143162157-143162179 CAGAGCCCTCCGGGGAGCCAGGG No data
1049532641_1049532655 7 Left 1049532641 8:143162137-143162159 CCCTCCACTTGGCACCCACACAG No data
Right 1049532655 8:143162167-143162189 CGGGGAGCCAGGGTGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049532641 Original CRISPR CTGTGTGGGTGCCAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr