ID: 1049533931

View in Genome Browser
Species Human (GRCh38)
Location 8:143169361-143169383
Sequence GAGGGTAAGCAGTAGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049533931_1049533946 21 Left 1049533931 8:143169361-143169383 CCATCATCCTACTGCTTACCCTC No data
Right 1049533946 8:143169405-143169427 ATAAAGGAAGAGGCCTGAAGAGG No data
1049533931_1049533942 5 Left 1049533931 8:143169361-143169383 CCATCATCCTACTGCTTACCCTC No data
Right 1049533942 8:143169389-143169411 GTCCAGGGTCAAGGCCATAAAGG No data
1049533931_1049533939 -4 Left 1049533931 8:143169361-143169383 CCATCATCCTACTGCTTACCCTC No data
Right 1049533939 8:143169380-143169402 CCTCCCTGGGTCCAGGGTCAAGG No data
1049533931_1049533944 11 Left 1049533931 8:143169361-143169383 CCATCATCCTACTGCTTACCCTC No data
Right 1049533944 8:143169395-143169417 GGTCAAGGCCATAAAGGAAGAGG No data
1049533931_1049533936 -10 Left 1049533931 8:143169361-143169383 CCATCATCCTACTGCTTACCCTC No data
Right 1049533936 8:143169374-143169396 GCTTACCCTCCCTGGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049533931 Original CRISPR GAGGGTAAGCAGTAGGATGA TGG (reversed) Intergenic
No off target data available for this crispr