ID: 1049534833

View in Genome Browser
Species Human (GRCh38)
Location 8:143174300-143174322
Sequence TAGGGTTCTTATGAAGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049534832_1049534833 -6 Left 1049534832 8:143174283-143174305 CCAACTGCAGTGTTCTTTAGGGT No data
Right 1049534833 8:143174300-143174322 TAGGGTTCTTATGAAGCTGAAGG No data
1049534830_1049534833 -5 Left 1049534830 8:143174282-143174304 CCCAACTGCAGTGTTCTTTAGGG No data
Right 1049534833 8:143174300-143174322 TAGGGTTCTTATGAAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049534833 Original CRISPR TAGGGTTCTTATGAAGCTGA AGG Intergenic
No off target data available for this crispr