ID: 1049536468

View in Genome Browser
Species Human (GRCh38)
Location 8:143184674-143184696
Sequence GCCCTTCAGGATCTAGGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049536458_1049536468 14 Left 1049536458 8:143184637-143184659 CCCACACACCCACAGGGAATCAG No data
Right 1049536468 8:143184674-143184696 GCCCTTCAGGATCTAGGTTTGGG No data
1049536460_1049536468 6 Left 1049536460 8:143184645-143184667 CCCACAGGGAATCAGAGCTGCCC No data
Right 1049536468 8:143184674-143184696 GCCCTTCAGGATCTAGGTTTGGG No data
1049536459_1049536468 13 Left 1049536459 8:143184638-143184660 CCACACACCCACAGGGAATCAGA No data
Right 1049536468 8:143184674-143184696 GCCCTTCAGGATCTAGGTTTGGG No data
1049536461_1049536468 5 Left 1049536461 8:143184646-143184668 CCACAGGGAATCAGAGCTGCCCT No data
Right 1049536468 8:143184674-143184696 GCCCTTCAGGATCTAGGTTTGGG No data
1049536456_1049536468 16 Left 1049536456 8:143184635-143184657 CCCCCACACACCCACAGGGAATC No data
Right 1049536468 8:143184674-143184696 GCCCTTCAGGATCTAGGTTTGGG No data
1049536457_1049536468 15 Left 1049536457 8:143184636-143184658 CCCCACACACCCACAGGGAATCA No data
Right 1049536468 8:143184674-143184696 GCCCTTCAGGATCTAGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049536468 Original CRISPR GCCCTTCAGGATCTAGGTTT GGG Intergenic
No off target data available for this crispr