ID: 1049536901

View in Genome Browser
Species Human (GRCh38)
Location 8:143186609-143186631
Sequence CAGGGTAGAGACGCTGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049536901_1049536909 16 Left 1049536901 8:143186609-143186631 CCTACCTCAGCGTCTCTACCCTG No data
Right 1049536909 8:143186648-143186670 ACCAATTGAGAGCAGTAAAAAGG No data
1049536901_1049536911 17 Left 1049536901 8:143186609-143186631 CCTACCTCAGCGTCTCTACCCTG No data
Right 1049536911 8:143186649-143186671 CCAATTGAGAGCAGTAAAAAGGG No data
1049536901_1049536906 -8 Left 1049536901 8:143186609-143186631 CCTACCTCAGCGTCTCTACCCTG No data
Right 1049536906 8:143186624-143186646 CTACCCTGGAACAGAGGACTGGG No data
1049536901_1049536905 -9 Left 1049536901 8:143186609-143186631 CCTACCTCAGCGTCTCTACCCTG No data
Right 1049536905 8:143186623-143186645 TCTACCCTGGAACAGAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049536901 Original CRISPR CAGGGTAGAGACGCTGAGGT AGG (reversed) Intergenic
No off target data available for this crispr