ID: 1049537437

View in Genome Browser
Species Human (GRCh38)
Location 8:143188894-143188916
Sequence CACTGCTGCGGGAGAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049537429_1049537437 1 Left 1049537429 8:143188870-143188892 CCCGCACAGCTGCTGAGGCCATT No data
Right 1049537437 8:143188894-143188916 CACTGCTGCGGGAGAATGGGTGG No data
1049537427_1049537437 9 Left 1049537427 8:143188862-143188884 CCAGGTCACCCGCACAGCTGCTG No data
Right 1049537437 8:143188894-143188916 CACTGCTGCGGGAGAATGGGTGG No data
1049537430_1049537437 0 Left 1049537430 8:143188871-143188893 CCGCACAGCTGCTGAGGCCATTC No data
Right 1049537437 8:143188894-143188916 CACTGCTGCGGGAGAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049537437 Original CRISPR CACTGCTGCGGGAGAATGGG TGG Intergenic
No off target data available for this crispr