ID: 1049537852

View in Genome Browser
Species Human (GRCh38)
Location 8:143190219-143190241
Sequence CGCTGTAAGAGGAGGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049537852_1049537859 5 Left 1049537852 8:143190219-143190241 CCCGCCTCCCTCCTCTTACAGCG No data
Right 1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049537852 Original CRISPR CGCTGTAAGAGGAGGGAGGC GGG (reversed) Intergenic
No off target data available for this crispr