ID: 1049537859

View in Genome Browser
Species Human (GRCh38)
Location 8:143190247-143190269
Sequence CCCCCTGCATTCGTTTCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049537855_1049537859 -2 Left 1049537855 8:143190226-143190248 CCCTCCTCTTACAGCGAGTGTCC No data
Right 1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG No data
1049537857_1049537859 -6 Left 1049537857 8:143190230-143190252 CCTCTTACAGCGAGTGTCCCCCT No data
Right 1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG No data
1049537851_1049537859 6 Left 1049537851 8:143190218-143190240 CCCCGCCTCCCTCCTCTTACAGC No data
Right 1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG No data
1049537853_1049537859 4 Left 1049537853 8:143190220-143190242 CCGCCTCCCTCCTCTTACAGCGA No data
Right 1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG No data
1049537854_1049537859 1 Left 1049537854 8:143190223-143190245 CCTCCCTCCTCTTACAGCGAGTG No data
Right 1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG No data
1049537852_1049537859 5 Left 1049537852 8:143190219-143190241 CCCGCCTCCCTCCTCTTACAGCG No data
Right 1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG No data
1049537850_1049537859 12 Left 1049537850 8:143190212-143190234 CCAGGTCCCCGCCTCCCTCCTCT No data
Right 1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG No data
1049537856_1049537859 -3 Left 1049537856 8:143190227-143190249 CCTCCTCTTACAGCGAGTGTCCC No data
Right 1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG No data
1049537847_1049537859 17 Left 1049537847 8:143190207-143190229 CCCTCCCAGGTCCCCGCCTCCCT No data
Right 1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG No data
1049537848_1049537859 16 Left 1049537848 8:143190208-143190230 CCTCCCAGGTCCCCGCCTCCCTC No data
Right 1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG No data
1049537849_1049537859 13 Left 1049537849 8:143190211-143190233 CCCAGGTCCCCGCCTCCCTCCTC No data
Right 1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049537859 Original CRISPR CCCCCTGCATTCGTTTCCTG CGG Intergenic
No off target data available for this crispr