ID: 1049539750

View in Genome Browser
Species Human (GRCh38)
Location 8:143202888-143202910
Sequence GTCCCTGGTCGTGGTGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049539750_1049539761 27 Left 1049539750 8:143202888-143202910 CCATCAGCACCACGACCAGGGAC No data
Right 1049539761 8:143202938-143202960 CTCCCAACTCACCACCTGGCTGG No data
1049539750_1049539755 -8 Left 1049539750 8:143202888-143202910 CCATCAGCACCACGACCAGGGAC No data
Right 1049539755 8:143202903-143202925 CCAGGGACGTGAGAGGCACAGGG No data
1049539750_1049539753 -9 Left 1049539750 8:143202888-143202910 CCATCAGCACCACGACCAGGGAC No data
Right 1049539753 8:143202902-143202924 ACCAGGGACGTGAGAGGCACAGG No data
1049539750_1049539760 23 Left 1049539750 8:143202888-143202910 CCATCAGCACCACGACCAGGGAC No data
Right 1049539760 8:143202934-143202956 CTCGCTCCCAACTCACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049539750 Original CRISPR GTCCCTGGTCGTGGTGCTGA TGG (reversed) Intergenic